Incidental Mutation 'R2049:Parp8'
ID 226262
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
MMRRC Submission 040056-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2049 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 116991356-117162073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117031422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 430 (D430V)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably benign
Transcript: ENSMUST00000022239
AA Change: D430V

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: D430V

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223949
AA Change: D391V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (118/122)
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,822,444 (GRCm39) R8* probably null Het
Abhd17a A G 10: 80,421,440 (GRCm39) probably null Het
Acsm1 A G 7: 119,255,262 (GRCm39) R415G probably damaging Het
Acta1 G T 8: 124,618,803 (GRCm39) T360N probably benign Het
Adam6a T A 12: 113,508,049 (GRCm39) S141T probably benign Het
Adgrd1 G T 5: 129,192,159 (GRCm39) K76N probably benign Het
Afdn A G 17: 14,030,695 (GRCm39) E202G probably damaging Het
Agps T A 2: 75,689,270 (GRCm39) M156K probably benign Het
Agxt A G 1: 93,065,037 (GRCm39) I149V probably benign Het
Aoc1l1 T A 6: 48,954,689 (GRCm39) L609* probably null Het
Aqp2 A G 15: 99,477,247 (GRCm39) T72A probably damaging Het
Arhgap18 T A 10: 26,725,938 (GRCm39) D54E probably benign Het
Asb8 C A 15: 98,033,950 (GRCm39) E202* probably null Het
Bmp5 A G 9: 75,801,072 (GRCm39) I401V probably damaging Het
Bscl2 T C 19: 8,822,684 (GRCm39) probably null Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cep112 A G 11: 108,497,151 (GRCm39) E697G probably damaging Het
Cerk G A 15: 86,027,009 (GRCm39) S167L probably benign Het
Chrm3 T A 13: 9,928,371 (GRCm39) I222F probably damaging Het
Clcn6 A G 4: 148,108,594 (GRCm39) F145S possibly damaging Het
Cnksr1 A G 4: 133,956,939 (GRCm39) Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Commd10 A T 18: 47,096,814 (GRCm39) T74S probably benign Het
Cyp4f39 T C 17: 32,701,112 (GRCm39) F201L probably benign Het
Dennd4a A G 9: 64,796,887 (GRCm39) T860A possibly damaging Het
Dlg5 A T 14: 24,204,715 (GRCm39) I1253N probably damaging Het
Dnah7b T A 1: 46,307,830 (GRCm39) M3048K probably damaging Het
Dnah9 A G 11: 65,935,509 (GRCm39) M1970T probably damaging Het
Dsc3 A T 18: 20,122,737 (GRCm39) D62E possibly damaging Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dusp7 C T 9: 106,251,096 (GRCm39) T407M probably damaging Het
Efnb1 A G X: 98,191,123 (GRCm39) Y343C probably damaging Het
Eif1ad8 A G 12: 87,564,046 (GRCm39) D127G unknown Het
Entpd5 A G 12: 84,443,632 (GRCm39) I12T probably benign Het
Espn T C 4: 152,205,714 (GRCm39) E408G probably damaging Het
Fhip1b A T 7: 105,039,046 (GRCm39) D64E probably damaging Het
Gdpd3 A G 7: 126,367,766 (GRCm39) T200A probably damaging Het
Gli1 A G 10: 127,172,596 (GRCm39) L182P probably damaging Het
Gm5134 G A 10: 75,840,718 (GRCm39) A521T possibly damaging Het
Gprasp1 G A X: 134,702,791 (GRCm39) E995K possibly damaging Het
H2-M10.1 T C 17: 36,636,108 (GRCm39) D153G possibly damaging Het
Helb A T 10: 119,941,926 (GRCm39) M254K possibly damaging Het
I0C0044D17Rik A G 4: 98,708,533 (GRCm39) probably benign Het
Igfn1 AGGG AGG 1: 135,902,590 (GRCm39) probably benign Het
Igfn1 T A 1: 135,898,376 (GRCm39) Q730L probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Jmjd1c T A 10: 66,993,777 (GRCm39) L86* probably null Het
Kat5 T A 19: 5,655,713 (GRCm39) probably null Het
Kif14 A G 1: 136,414,818 (GRCm39) N768S probably benign Het
Kif14 A G 1: 136,437,905 (GRCm39) E1199G possibly damaging Het
Klhl29 A G 12: 5,187,876 (GRCm39) S163P probably damaging Het
Kmt2c C A 5: 25,490,077 (GRCm39) Q4287H probably damaging Het
Krt82 T A 15: 101,453,591 (GRCm39) Q265L probably damaging Het
Macf1 C T 4: 123,248,895 (GRCm39) C7210Y probably damaging Het
Mx2 G A 16: 97,339,903 (GRCm39) E20K probably benign Het
Myom2 T G 8: 15,156,379 (GRCm39) I742S probably damaging Het
Narf A T 11: 121,141,195 (GRCm39) R310* probably null Het
Nktr T A 9: 121,570,760 (GRCm39) D167E probably damaging Het
Nle1 A G 11: 82,796,192 (GRCm39) W183R probably damaging Het
Npas3 A G 12: 54,108,871 (GRCm39) N425S probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or4a27 A T 2: 88,559,089 (GRCm39) Y285N probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or4d5 T A 9: 40,012,415 (GRCm39) I124L probably benign Het
Or6c69 A G 10: 129,748,036 (GRCm39) V37A probably benign Het
Or8g52 A T 9: 39,631,411 (GRCm39) D296V probably damaging Het
Or8s2 G A 15: 98,276,277 (GRCm39) T238I possibly damaging Het
Otol1 T A 3: 69,926,169 (GRCm39) F115I probably benign Het
Pex7 T A 10: 19,770,061 (GRCm39) H123L probably damaging Het
Pkhd1l1 T A 15: 44,410,909 (GRCm39) probably benign Het
Pkhd1l1 G A 15: 44,445,137 (GRCm39) D3670N probably damaging Het
Plec T C 15: 76,067,374 (GRCm39) T1331A probably benign Het
Plekha4 A G 7: 45,203,222 (GRCm39) D704G probably benign Het
Plxnb2 T A 15: 89,043,205 (GRCm39) N1453I probably damaging Het
Pms1 T A 1: 53,321,147 (GRCm39) I29F probably damaging Het
Ppp1r1a G A 15: 103,439,833 (GRCm39) T153I probably damaging Het
Pramel12 T A 4: 143,143,441 (GRCm39) L69Q probably damaging Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptpre A G 7: 135,272,424 (GRCm39) probably benign Het
Ptprt A T 2: 161,376,465 (GRCm39) I1312N probably damaging Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Rims1 C T 1: 22,635,516 (GRCm39) C155Y probably damaging Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Slitrk6 T G 14: 110,988,226 (GRCm39) T494P probably benign Het
Sltm G A 9: 70,488,583 (GRCm39) G578S probably benign Het
Smyd5 A G 6: 85,421,300 (GRCm39) E338G probably benign Het
Snx2 G A 18: 53,327,516 (GRCm39) V81M probably damaging Het
Sp2 G T 11: 96,852,191 (GRCm39) N244K probably benign Het
Sspo C A 6: 48,437,697 (GRCm39) probably benign Het
Sspo A C 6: 48,440,465 (GRCm39) D1568A probably benign Het
Ssrp1 T C 2: 84,871,771 (GRCm39) probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,674,479 (GRCm39) probably benign Het
Syt7 G A 19: 10,416,577 (GRCm39) R138Q probably benign Het
Taar7f T C 10: 23,926,323 (GRCm39) Y306H possibly damaging Het
Tbccd1 T C 16: 22,637,291 (GRCm39) probably null Het
Tesl1 T A X: 23,773,549 (GRCm39) V350E probably benign Het
Tex261 A G 6: 83,749,241 (GRCm39) Y119H probably damaging Het
Tmem131l T G 3: 83,850,095 (GRCm39) E234D probably damaging Het
Tnnt2 TG TGG 1: 135,774,499 (GRCm39) probably benign Het
Top6bl A G 19: 4,748,633 (GRCm39) probably benign Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 (GRCm39) A157V probably damaging Het
Ubr4 C T 4: 139,204,518 (GRCm39) T4810M probably damaging Het
Uso1 G A 5: 92,329,795 (GRCm39) G427R probably damaging Het
Usp15 A T 10: 122,955,042 (GRCm39) V912D probably damaging Het
Vmn1r20 T C 6: 57,408,943 (GRCm39) S90P probably damaging Het
Vmn1r32 T C 6: 66,530,545 (GRCm39) K77R probably damaging Het
Vmn2r100 A G 17: 19,742,312 (GRCm39) K229E probably benign Het
Vmn2r106 A G 17: 20,488,566 (GRCm39) V611A possibly damaging Het
Xrcc6 T A 15: 81,907,178 (GRCm39) F167I probably damaging Het
Zbtb21 G T 16: 97,751,355 (GRCm39) P804H probably damaging Het
Zdhhc3 T C 9: 122,929,602 (GRCm39) D11G probably damaging Het
Zfhx3 A G 8: 109,671,809 (GRCm39) T1324A probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,553,091 (GRCm39) probably benign Het
Zfp608 G T 18: 55,028,637 (GRCm39) L1259I probably damaging Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 117,063,859 (GRCm39) missense probably damaging 1.00
IGL01346:Parp8 APN 13 117,031,600 (GRCm39) missense possibly damaging 0.72
IGL01793:Parp8 APN 13 117,047,415 (GRCm39) missense probably damaging 1.00
IGL01926:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL01958:Parp8 APN 13 117,013,108 (GRCm39) missense probably benign 0.14
IGL02131:Parp8 APN 13 117,047,409 (GRCm39) missense probably benign 0.08
IGL02398:Parp8 APN 13 117,047,399 (GRCm39) critical splice donor site probably null
IGL02496:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL03135:Parp8 APN 13 117,047,478 (GRCm39) missense probably benign 0.41
IGL03143:Parp8 APN 13 117,047,497 (GRCm39) splice site probably benign
IGL03201:Parp8 APN 13 116,999,605 (GRCm39) splice site probably benign
blondi UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
Heidi UTSW 13 116,998,740 (GRCm39) splice site probably null
R0362:Parp8 UTSW 13 117,061,504 (GRCm39) nonsense probably null
R0699:Parp8 UTSW 13 117,059,120 (GRCm39) missense probably benign 0.01
R1445:Parp8 UTSW 13 117,161,886 (GRCm39) splice site probably null
R1676:Parp8 UTSW 13 117,014,064 (GRCm39) missense probably damaging 0.99
R1977:Parp8 UTSW 13 117,047,449 (GRCm39) missense probably damaging 0.96
R2019:Parp8 UTSW 13 117,004,968 (GRCm39) splice site probably benign
R2142:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2474:Parp8 UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
R2566:Parp8 UTSW 13 117,032,223 (GRCm39) missense possibly damaging 0.78
R3863:Parp8 UTSW 13 117,031,303 (GRCm39) missense probably benign 0.01
R4126:Parp8 UTSW 13 117,005,005 (GRCm39) missense possibly damaging 0.94
R4518:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4519:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4767:Parp8 UTSW 13 117,005,072 (GRCm39) missense probably damaging 0.99
R5355:Parp8 UTSW 13 116,998,740 (GRCm39) splice site probably null
R5633:Parp8 UTSW 13 117,013,116 (GRCm39) missense probably damaging 1.00
R5942:Parp8 UTSW 13 117,005,969 (GRCm39) missense probably benign 0.12
R5978:Parp8 UTSW 13 117,032,268 (GRCm39) missense probably benign 0.01
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6753:Parp8 UTSW 13 117,031,651 (GRCm39) missense possibly damaging 0.91
R7016:Parp8 UTSW 13 117,031,627 (GRCm39) missense probably damaging 1.00
R7139:Parp8 UTSW 13 117,161,802 (GRCm39) missense probably benign 0.21
R7305:Parp8 UTSW 13 117,031,461 (GRCm39) missense possibly damaging 0.95
R7314:Parp8 UTSW 13 117,004,996 (GRCm39) missense probably benign 0.01
R7360:Parp8 UTSW 13 117,032,307 (GRCm39) missense probably benign 0.02
R7526:Parp8 UTSW 13 117,031,341 (GRCm39) missense probably damaging 1.00
R8078:Parp8 UTSW 13 117,061,519 (GRCm39) missense probably damaging 1.00
R8108:Parp8 UTSW 13 117,003,609 (GRCm39) nonsense probably null
R8372:Parp8 UTSW 13 116,991,786 (GRCm39) missense probably damaging 1.00
R9005:Parp8 UTSW 13 117,013,126 (GRCm39) missense probably benign
R9072:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9073:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9351:Parp8 UTSW 13 117,000,781 (GRCm39) missense probably damaging 0.99
R9441:Parp8 UTSW 13 117,029,562 (GRCm39) missense probably damaging 1.00
R9448:Parp8 UTSW 13 117,039,360 (GRCm39) nonsense probably null
R9470:Parp8 UTSW 13 117,031,292 (GRCm39) missense probably benign 0.02
R9562:Parp8 UTSW 13 117,029,631 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACCGATAAGCCCTGAGGTAAGC -3'
(R):5'- TGATATGTGTGCCAAGTCGC -3'

Sequencing Primer
(F):5'- AGAGCCTCCTGCCCTCTG -3'
(R):5'- AAGTCGCACAGGACCTTCG -3'
Posted On 2014-09-17