Incidental Mutation 'R2050:4930548H24Rik'
ID226320
Institutional Source Beutler Lab
Gene Symbol 4930548H24Rik
Ensembl Gene ENSMUSG00000029138
Gene NameRIKEN cDNA 4930548H24 gene
Synonyms
MMRRC Submission 040057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2050 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31485740-31488476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31486058 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 44 (I44T)
Ref Sequence ENSEMBL: ENSMUSP00000031020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031020] [ENSMUST00000076264] [ENSMUST00000202244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031020
AA Change: I44T

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031020
Gene: ENSMUSG00000029138
AA Change: I44T

DomainStartEndE-ValueType
coiled coil region 151 195 N/A INTRINSIC
Pfam:DUF4515 202 407 2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076264
SMART Domains Protein: ENSMUSP00000075613
Gene: ENSMUSG00000062761

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 2e-8 BLAST
ZnF_C2H2 200 223 3.78e-1 SMART
ZnF_C2H2 254 276 2.63e2 SMART
ZnF_C2H2 290 313 3.39e-3 SMART
ZnF_C2H2 408 430 7.37e1 SMART
ZnF_C2H2 442 465 3.11e-2 SMART
low complexity region 485 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201177
Predicted Effect probably benign
Transcript: ENSMUST00000202244
SMART Domains Protein: ENSMUSP00000143860
Gene: ENSMUSG00000062761

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 1e-8 BLAST
ZnF_C2H2 200 223 1.6e-3 SMART
ZnF_C2H2 352 374 3.2e-1 SMART
ZnF_C2H2 386 409 1.4e-4 SMART
low complexity region 429 455 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202605
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 G T 10: 127,080,261 E214* probably null Het
Angpt2 G T 8: 18,705,657 P265T probably benign Het
Apc2 C A 10: 80,307,609 probably null Het
Arpc1b C T 5: 145,125,919 P250S probably damaging Het
Atxn10 T G 15: 85,365,312 V115G probably benign Het
Bace2 T A 16: 97,412,136 C100S probably damaging Het
Bpifb9b T C 2: 154,309,604 S82P possibly damaging Het
Cacna1g A G 11: 94,409,474 S2157P probably damaging Het
Cacnb4 T A 2: 52,469,586 I104L probably damaging Het
Cdh6 T A 15: 13,057,501 M245L probably benign Het
Celsr1 A C 15: 86,030,547 V1075G probably benign Het
Cfap61 T C 2: 146,145,473 F1065L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 T C 8: 71,617,686 probably null Het
Ctnnal1 A T 4: 56,835,350 V309D probably benign Het
D7Ertd443e T A 7: 134,266,798 E659D probably damaging Het
Dab2 T C 15: 6,435,215 Y516H possibly damaging Het
Dnah14 T C 1: 181,752,562 L3099P probably damaging Het
Frem3 A G 8: 80,614,891 E1271G probably damaging Het
Gm14085 T C 2: 122,522,868 S510P probably benign Het
Grap2 A G 15: 80,646,243 H188R probably benign Het
Grin2c T C 11: 115,257,419 D344G possibly damaging Het
Hmcn2 T C 2: 31,335,436 M119T probably damaging Het
Hsd11b2 A G 8: 105,523,360 I368V probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1bl2 T A 19: 34,619,470 N249Y possibly damaging Het
Igsf8 T A 1: 172,318,865 Y36N probably damaging Het
Lrp12 G A 15: 39,872,589 S649L probably damaging Het
Map2 T C 1: 66,414,314 S788P probably damaging Het
Mast4 T C 13: 102,751,409 D1164G probably damaging Het
Mcm9 A G 10: 53,612,825 probably null Het
Myo5a G A 9: 75,146,874 E355K probably benign Het
Myo9b T A 8: 71,290,550 V85E probably damaging Het
Nbeal1 G A 1: 60,292,964 probably null Het
Nlrx1 A T 9: 44,262,780 W375R probably damaging Het
Pik3c2a A G 7: 116,417,451 probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Plk4 T A 3: 40,810,380 M603K probably benign Het
Rfx7 T A 9: 72,617,466 V646E probably benign Het
Slc9a1 A G 4: 133,416,334 H377R probably benign Het
Snrnp70 A C 7: 45,387,300 Y61* probably null Het
Spatc1l T C 10: 76,564,058 L138P probably damaging Het
Spink5 T C 18: 44,007,758 probably null Het
Sptan1 T A 2: 30,002,238 S1055T probably benign Het
Tas2r104 T A 6: 131,685,120 M209L probably damaging Het
Tdrd12 C T 7: 35,529,247 V17I probably damaging Het
Tmem129 C A 5: 33,657,782 A16S probably benign Het
Tmtc1 T C 6: 148,262,883 E584G probably damaging Het
Trank1 C A 9: 111,364,788 H627N probably damaging Het
Trio T C 15: 27,851,945 D820G possibly damaging Het
Trpt1 T A 19: 6,998,084 N98K probably damaging Het
Ube4b A T 4: 149,344,612 F857I probably damaging Het
Vmn2r45 A G 7: 8,472,022 V669A probably damaging Het
Vmn2r71 A G 7: 85,624,473 I832V probably damaging Het
Zbtb20 T A 16: 43,609,612 probably null Het
Zfyve9 A C 4: 108,718,603 M427R probably benign Het
Zfyve9 A T 4: 108,719,303 F194I possibly damaging Het
Other mutations in 4930548H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:4930548H24Rik APN 5 31487427 missense probably benign 0.00
IGL02009:4930548H24Rik APN 5 31487491 missense probably benign 0.00
FR4304:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4340:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4342:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4589:4930548H24Rik UTSW 5 31487373 small deletion probably benign
LCD18:4930548H24Rik UTSW 5 31487373 small deletion probably benign
PIT4486001:4930548H24Rik UTSW 5 31487743 missense probably damaging 0.99
R0650:4930548H24Rik UTSW 5 31485968 unclassified probably benign
R1366:4930548H24Rik UTSW 5 31487517 missense probably benign 0.07
R2070:4930548H24Rik UTSW 5 31487383 missense possibly damaging 0.91
R2862:4930548H24Rik UTSW 5 31485911 unclassified probably benign
R3965:4930548H24Rik UTSW 5 31487991 missense probably benign 0.02
R4299:4930548H24Rik UTSW 5 31487526 missense possibly damaging 0.82
R4634:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4635:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4637:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4887:4930548H24Rik UTSW 5 31486252 missense probably benign 0.19
R5587:4930548H24Rik UTSW 5 31486084 missense probably benign
R5897:4930548H24Rik UTSW 5 31485964 unclassified probably benign
R6181:4930548H24Rik UTSW 5 31488055 missense probably damaging 0.98
R6183:4930548H24Rik UTSW 5 31487976 missense probably damaging 0.99
RF006:4930548H24Rik UTSW 5 31487550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAGGGAACATTTGACC -3'
(R):5'- AAGAACTGGTGCCACACGTC -3'

Sequencing Primer
(F):5'- ATTTGACCCCCAATCTGAGGG -3'
(R):5'- ACACGTCTGCCTTTGGG -3'
Posted On2014-09-17