Incidental Mutation 'R2050:Vmn2r45'
ID226330
Institutional Source Beutler Lab
Gene Symbol Vmn2r45
Ensembl Gene ENSMUSG00000090662
Gene Namevomeronasal 2, receptor 45
Synonyms
MMRRC Submission 040057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2050 (G1)
Quality Score130
Status Not validated
Chromosome7
Chromosomal Location8470525-8489075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8472022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 669 (V669A)
Ref Sequence ENSEMBL: ENSMUSP00000129466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164845]
Predicted Effect probably damaging
Transcript: ENSMUST00000164845
AA Change: V669A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: V669A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 469 4.5e-26 PFAM
Pfam:NCD3G 512 565 6.4e-21 PFAM
Pfam:7tm_3 598 833 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,486,058 I44T possibly damaging Het
Agap2 G T 10: 127,080,261 E214* probably null Het
Angpt2 G T 8: 18,705,657 P265T probably benign Het
Apc2 C A 10: 80,307,609 probably null Het
Arpc1b C T 5: 145,125,919 P250S probably damaging Het
Atxn10 T G 15: 85,365,312 V115G probably benign Het
Bace2 T A 16: 97,412,136 C100S probably damaging Het
Bpifb9b T C 2: 154,309,604 S82P possibly damaging Het
Cacna1g A G 11: 94,409,474 S2157P probably damaging Het
Cacnb4 T A 2: 52,469,586 I104L probably damaging Het
Cdh6 T A 15: 13,057,501 M245L probably benign Het
Celsr1 A C 15: 86,030,547 V1075G probably benign Het
Cfap61 T C 2: 146,145,473 F1065L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 T C 8: 71,617,686 probably null Het
Ctnnal1 A T 4: 56,835,350 V309D probably benign Het
D7Ertd443e T A 7: 134,266,798 E659D probably damaging Het
Dab2 T C 15: 6,435,215 Y516H possibly damaging Het
Dnah14 T C 1: 181,752,562 L3099P probably damaging Het
Frem3 A G 8: 80,614,891 E1271G probably damaging Het
Gm14085 T C 2: 122,522,868 S510P probably benign Het
Grap2 A G 15: 80,646,243 H188R probably benign Het
Grin2c T C 11: 115,257,419 D344G possibly damaging Het
Hmcn2 T C 2: 31,335,436 M119T probably damaging Het
Hsd11b2 A G 8: 105,523,360 I368V probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1bl2 T A 19: 34,619,470 N249Y possibly damaging Het
Igsf8 T A 1: 172,318,865 Y36N probably damaging Het
Lrp12 G A 15: 39,872,589 S649L probably damaging Het
Map2 T C 1: 66,414,314 S788P probably damaging Het
Mast4 T C 13: 102,751,409 D1164G probably damaging Het
Mcm9 A G 10: 53,612,825 probably null Het
Myo5a G A 9: 75,146,874 E355K probably benign Het
Myo9b T A 8: 71,290,550 V85E probably damaging Het
Nbeal1 G A 1: 60,292,964 probably null Het
Nlrx1 A T 9: 44,262,780 W375R probably damaging Het
Pik3c2a A G 7: 116,417,451 probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Plk4 T A 3: 40,810,380 M603K probably benign Het
Rfx7 T A 9: 72,617,466 V646E probably benign Het
Slc9a1 A G 4: 133,416,334 H377R probably benign Het
Snrnp70 A C 7: 45,387,300 Y61* probably null Het
Spatc1l T C 10: 76,564,058 L138P probably damaging Het
Spink5 T C 18: 44,007,758 probably null Het
Sptan1 T A 2: 30,002,238 S1055T probably benign Het
Tas2r104 T A 6: 131,685,120 M209L probably damaging Het
Tdrd12 C T 7: 35,529,247 V17I probably damaging Het
Tmem129 C A 5: 33,657,782 A16S probably benign Het
Tmtc1 T C 6: 148,262,883 E584G probably damaging Het
Trank1 C A 9: 111,364,788 H627N probably damaging Het
Trio T C 15: 27,851,945 D820G possibly damaging Het
Trpt1 T A 19: 6,998,084 N98K probably damaging Het
Ube4b A T 4: 149,344,612 F857I probably damaging Het
Vmn2r71 A G 7: 85,624,473 I832V probably damaging Het
Zbtb20 T A 16: 43,609,612 probably null Het
Zfyve9 A T 4: 108,719,303 F194I possibly damaging Het
Zfyve9 A C 4: 108,718,603 M427R probably benign Het
Other mutations in Vmn2r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn2r45 APN 7 8485623 missense probably benign 0.00
IGL01322:Vmn2r45 APN 7 8481333 missense possibly damaging 0.49
IGL01402:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01404:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01529:Vmn2r45 APN 7 8483494 missense probably benign
IGL01596:Vmn2r45 APN 7 8483273 missense probably damaging 0.98
IGL01646:Vmn2r45 APN 7 8483338 missense probably benign 0.18
IGL01819:Vmn2r45 APN 7 8485557 missense probably benign 0.00
IGL02096:Vmn2r45 APN 7 8481444 missense probably damaging 0.99
IGL02130:Vmn2r45 APN 7 8483557 missense possibly damaging 0.46
IGL02409:Vmn2r45 APN 7 8485728 missense probably benign 0.03
IGL02517:Vmn2r45 APN 7 8483186 nonsense probably null
IGL02633:Vmn2r45 APN 7 8485729 missense probably benign 0.01
IGL02940:Vmn2r45 APN 7 8472370 missense probably damaging 0.99
IGL03281:Vmn2r45 APN 7 8483604 missense probably damaging 1.00
IGL03358:Vmn2r45 APN 7 8471716 missense probably damaging 1.00
BB004:Vmn2r45 UTSW 7 8483514 missense probably benign
BB014:Vmn2r45 UTSW 7 8483514 missense probably benign
R0382:Vmn2r45 UTSW 7 8483099 missense probably benign 0.06
R0532:Vmn2r45 UTSW 7 8471821 missense probably damaging 0.99
R0932:Vmn2r45 UTSW 7 8475381 missense probably damaging 1.00
R1125:Vmn2r45 UTSW 7 8485543 missense probably benign 0.00
R1580:Vmn2r45 UTSW 7 8471747 missense possibly damaging 0.95
R1817:Vmn2r45 UTSW 7 8472373 missense probably damaging 1.00
R1996:Vmn2r45 UTSW 7 8472025 missense probably damaging 1.00
R2284:Vmn2r45 UTSW 7 8485766 missense probably benign 0.02
R4019:Vmn2r45 UTSW 7 8471581 nonsense probably null
R4227:Vmn2r45 UTSW 7 8483278 missense probably damaging 0.98
R4381:Vmn2r45 UTSW 7 8471913 nonsense probably null
R4618:Vmn2r45 UTSW 7 8483437 missense probably benign 0.00
R4624:Vmn2r45 UTSW 7 8481342 missense probably damaging 1.00
R4704:Vmn2r45 UTSW 7 8483536 nonsense probably null
R4735:Vmn2r45 UTSW 7 8483473 missense probably damaging 1.00
R4868:Vmn2r45 UTSW 7 8481481 missense probably benign 0.06
R4983:Vmn2r45 UTSW 7 8483117 missense probably damaging 0.99
R5246:Vmn2r45 UTSW 7 8483252 missense probably benign 0.00
R5430:Vmn2r45 UTSW 7 8483334 nonsense probably null
R5504:Vmn2r45 UTSW 7 8483177 missense probably benign 0.03
R5511:Vmn2r45 UTSW 7 8471833 missense probably benign 0.19
R5745:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R5814:Vmn2r45 UTSW 7 8471476 missense probably benign 0.00
R6223:Vmn2r45 UTSW 7 8483302 missense probably benign
R6267:Vmn2r45 UTSW 7 8472208 missense probably benign 0.26
R6623:Vmn2r45 UTSW 7 8471501 missense probably benign 0.09
R6999:Vmn2r45 UTSW 7 8483220 missense probably benign
R7242:Vmn2r45 UTSW 7 8485613 nonsense probably null
R7491:Vmn2r45 UTSW 7 8481343 missense probably benign 0.27
R7620:Vmn2r45 UTSW 7 8483223 nonsense probably null
R7719:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7720:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7853:Vmn2r45 UTSW 7 8482988 missense possibly damaging 0.90
R7873:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R7882:Vmn2r45 UTSW 7 8483410 missense possibly damaging 0.82
R7927:Vmn2r45 UTSW 7 8483514 missense probably benign
U24488:Vmn2r45 UTSW 7 8472362 missense probably damaging 1.00
Z1088:Vmn2r45 UTSW 7 8471485 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTAACTGAGCCCTTGTTGCAC -3'
(R):5'- ATGACACTCCTATTGTGAAGGCC -3'

Sequencing Primer
(F):5'- GAGCCCTTGTTGCACACAATG -3'
(R):5'- CTCCTATTGTGAAGGCCAATAACAG -3'
Posted On2014-09-17