Incidental Mutation 'R2050:Tdrd12'
ID226331
Institutional Source Beutler Lab
Gene Symbol Tdrd12
Ensembl Gene ENSMUSG00000030491
Gene Nametudor domain containing 12
SynonymsEG434165, 2410070K17Rik, ecat8, 2410004F06Rik, G1-476-14, repro23
MMRRC Submission 040057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R2050 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location35469098-35537745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35529247 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 17 (V17I)
Ref Sequence ENSEMBL: ENSMUSP00000141796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032701] [ENSMUST00000127472] [ENSMUST00000187190] [ENSMUST00000193633] [ENSMUST00000205407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032701
AA Change: V17I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032701
Gene: ENSMUSG00000030491
AA Change: V17I

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127472
SMART Domains Protein: ENSMUSP00000118671
Gene: ENSMUSG00000030491

DomainStartEndE-ValueType
Pfam:TUDOR 3 76 6.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187190
AA Change: V17I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140328
Gene: ENSMUSG00000030491
AA Change: V17I

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 5.1e-24 PFAM
Pfam:DEAD 276 581 1.8e-6 PFAM
Pfam:TUDOR 852 973 4.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193633
AA Change: V17I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491
AA Change: V17I

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205407
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous males are infertile with small testes. Spermatogenesis is arrested predominantly at the pachytene spermatocyte stage. Retrotransposon hopping is derepressed in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,486,058 I44T possibly damaging Het
Agap2 G T 10: 127,080,261 E214* probably null Het
Angpt2 G T 8: 18,705,657 P265T probably benign Het
Apc2 C A 10: 80,307,609 probably null Het
Arpc1b C T 5: 145,125,919 P250S probably damaging Het
Atxn10 T G 15: 85,365,312 V115G probably benign Het
Bace2 T A 16: 97,412,136 C100S probably damaging Het
Bpifb9b T C 2: 154,309,604 S82P possibly damaging Het
Cacna1g A G 11: 94,409,474 S2157P probably damaging Het
Cacnb4 T A 2: 52,469,586 I104L probably damaging Het
Cdh6 T A 15: 13,057,501 M245L probably benign Het
Celsr1 A C 15: 86,030,547 V1075G probably benign Het
Cfap61 T C 2: 146,145,473 F1065L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 T C 8: 71,617,686 probably null Het
Ctnnal1 A T 4: 56,835,350 V309D probably benign Het
D7Ertd443e T A 7: 134,266,798 E659D probably damaging Het
Dab2 T C 15: 6,435,215 Y516H possibly damaging Het
Dnah14 T C 1: 181,752,562 L3099P probably damaging Het
Frem3 A G 8: 80,614,891 E1271G probably damaging Het
Gm14085 T C 2: 122,522,868 S510P probably benign Het
Grap2 A G 15: 80,646,243 H188R probably benign Het
Grin2c T C 11: 115,257,419 D344G possibly damaging Het
Hmcn2 T C 2: 31,335,436 M119T probably damaging Het
Hsd11b2 A G 8: 105,523,360 I368V probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1bl2 T A 19: 34,619,470 N249Y possibly damaging Het
Igsf8 T A 1: 172,318,865 Y36N probably damaging Het
Lrp12 G A 15: 39,872,589 S649L probably damaging Het
Map2 T C 1: 66,414,314 S788P probably damaging Het
Mast4 T C 13: 102,751,409 D1164G probably damaging Het
Mcm9 A G 10: 53,612,825 probably null Het
Myo5a G A 9: 75,146,874 E355K probably benign Het
Myo9b T A 8: 71,290,550 V85E probably damaging Het
Nbeal1 G A 1: 60,292,964 probably null Het
Nlrx1 A T 9: 44,262,780 W375R probably damaging Het
Pik3c2a A G 7: 116,417,451 probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Plk4 T A 3: 40,810,380 M603K probably benign Het
Rfx7 T A 9: 72,617,466 V646E probably benign Het
Slc9a1 A G 4: 133,416,334 H377R probably benign Het
Snrnp70 A C 7: 45,387,300 Y61* probably null Het
Spatc1l T C 10: 76,564,058 L138P probably damaging Het
Spink5 T C 18: 44,007,758 probably null Het
Sptan1 T A 2: 30,002,238 S1055T probably benign Het
Tas2r104 T A 6: 131,685,120 M209L probably damaging Het
Tmem129 C A 5: 33,657,782 A16S probably benign Het
Tmtc1 T C 6: 148,262,883 E584G probably damaging Het
Trank1 C A 9: 111,364,788 H627N probably damaging Het
Trio T C 15: 27,851,945 D820G possibly damaging Het
Trpt1 T A 19: 6,998,084 N98K probably damaging Het
Ube4b A T 4: 149,344,612 F857I probably damaging Het
Vmn2r45 A G 7: 8,472,022 V669A probably damaging Het
Vmn2r71 A G 7: 85,624,473 I832V probably damaging Het
Zbtb20 T A 16: 43,609,612 probably null Het
Zfyve9 A C 4: 108,718,603 M427R probably benign Het
Zfyve9 A T 4: 108,719,303 F194I possibly damaging Het
Other mutations in Tdrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Tdrd12 APN 7 35505034 missense possibly damaging 0.95
IGL01879:Tdrd12 APN 7 35521923 missense probably damaging 1.00
IGL02026:Tdrd12 APN 7 35504233 splice site probably benign
IGL02186:Tdrd12 APN 7 35501401 missense probably damaging 0.99
PIT4131001:Tdrd12 UTSW 7 35481103 nonsense probably null
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0098:Tdrd12 UTSW 7 35475993 missense probably damaging 1.00
R0366:Tdrd12 UTSW 7 35508802 missense probably benign 0.25
R2851:Tdrd12 UTSW 7 35485373 missense probably damaging 1.00
R3715:Tdrd12 UTSW 7 35504980 missense probably benign 0.05
R3859:Tdrd12 UTSW 7 35493820 missense possibly damaging 0.50
R3912:Tdrd12 UTSW 7 35487713 missense probably damaging 1.00
R4656:Tdrd12 UTSW 7 35485254 missense probably damaging 1.00
R4826:Tdrd12 UTSW 7 35504157 missense probably benign 0.00
R4969:Tdrd12 UTSW 7 35487295 splice site probably null
R5202:Tdrd12 UTSW 7 35490030 missense possibly damaging 0.49
R5321:Tdrd12 UTSW 7 35478094 missense probably damaging 1.00
R5642:Tdrd12 UTSW 7 35511300 missense probably damaging 0.99
R5709:Tdrd12 UTSW 7 35476053 missense probably damaging 1.00
R5835:Tdrd12 UTSW 7 35529264 missense probably damaging 1.00
R6029:Tdrd12 UTSW 7 35485230 missense probably damaging 0.98
R6101:Tdrd12 UTSW 7 35481133 nonsense probably null
R6341:Tdrd12 UTSW 7 35490048 missense probably damaging 1.00
R6631:Tdrd12 UTSW 7 35485229 missense probably damaging 0.99
R6939:Tdrd12 UTSW 7 35485599 critical splice donor site probably null
R7032:Tdrd12 UTSW 7 35481046 nonsense probably null
R7058:Tdrd12 UTSW 7 35478109 missense unknown
R7096:Tdrd12 UTSW 7 35487589 missense
R7203:Tdrd12 UTSW 7 35489223 nonsense probably null
R7229:Tdrd12 UTSW 7 35480280 missense unknown
R7265:Tdrd12 UTSW 7 35487722 missense
R7284:Tdrd12 UTSW 7 35480136 splice site probably null
R7347:Tdrd12 UTSW 7 35485692 missense
R7501:Tdrd12 UTSW 7 35478091 missense unknown
R7789:Tdrd12 UTSW 7 35488692 missense
R8374:Tdrd12 UTSW 7 35478061 missense unknown
R8379:Tdrd12 UTSW 7 35524057 nonsense probably null
R8798:Tdrd12 UTSW 7 35529180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGTTTTAAGACTCTGAGATC -3'
(R):5'- CACGCATAATTGAGAATTGTTTGCC -3'

Sequencing Primer
(F):5'- CTGTTTTAAGACTCTGAGATCAAAGC -3'
(R):5'- TCTGGAACTCACTATGTAGACCAGG -3'
Posted On2014-09-17