Incidental Mutation 'R2050:Hsh2d'
ID226341
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission 040057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R2050 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72200460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 229 (D229N)
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098630
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211946
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,486,058 I44T possibly damaging Het
Agap2 G T 10: 127,080,261 E214* probably null Het
Angpt2 G T 8: 18,705,657 P265T probably benign Het
Apc2 C A 10: 80,307,609 probably null Het
Arpc1b C T 5: 145,125,919 P250S probably damaging Het
Atxn10 T G 15: 85,365,312 V115G probably benign Het
Bace2 T A 16: 97,412,136 C100S probably damaging Het
Bpifb9b T C 2: 154,309,604 S82P possibly damaging Het
Cacna1g A G 11: 94,409,474 S2157P probably damaging Het
Cacnb4 T A 2: 52,469,586 I104L probably damaging Het
Cdh6 T A 15: 13,057,501 M245L probably benign Het
Celsr1 A C 15: 86,030,547 V1075G probably benign Het
Cfap61 T C 2: 146,145,473 F1065L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 T C 8: 71,617,686 probably null Het
Ctnnal1 A T 4: 56,835,350 V309D probably benign Het
D7Ertd443e T A 7: 134,266,798 E659D probably damaging Het
Dab2 T C 15: 6,435,215 Y516H possibly damaging Het
Dnah14 T C 1: 181,752,562 L3099P probably damaging Het
Frem3 A G 8: 80,614,891 E1271G probably damaging Het
Gm14085 T C 2: 122,522,868 S510P probably benign Het
Grap2 A G 15: 80,646,243 H188R probably benign Het
Grin2c T C 11: 115,257,419 D344G possibly damaging Het
Hmcn2 T C 2: 31,335,436 M119T probably damaging Het
Hsd11b2 A G 8: 105,523,360 I368V probably benign Het
Ifit1bl2 T A 19: 34,619,470 N249Y possibly damaging Het
Igsf8 T A 1: 172,318,865 Y36N probably damaging Het
Lrp12 G A 15: 39,872,589 S649L probably damaging Het
Map2 T C 1: 66,414,314 S788P probably damaging Het
Mast4 T C 13: 102,751,409 D1164G probably damaging Het
Mcm9 A G 10: 53,612,825 probably null Het
Myo5a G A 9: 75,146,874 E355K probably benign Het
Myo9b T A 8: 71,290,550 V85E probably damaging Het
Nbeal1 G A 1: 60,292,964 probably null Het
Nlrx1 A T 9: 44,262,780 W375R probably damaging Het
Pik3c2a A G 7: 116,417,451 probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Plk4 T A 3: 40,810,380 M603K probably benign Het
Rfx7 T A 9: 72,617,466 V646E probably benign Het
Slc9a1 A G 4: 133,416,334 H377R probably benign Het
Snrnp70 A C 7: 45,387,300 Y61* probably null Het
Spatc1l T C 10: 76,564,058 L138P probably damaging Het
Spink5 T C 18: 44,007,758 probably null Het
Sptan1 T A 2: 30,002,238 S1055T probably benign Het
Tas2r104 T A 6: 131,685,120 M209L probably damaging Het
Tdrd12 C T 7: 35,529,247 V17I probably damaging Het
Tmem129 C A 5: 33,657,782 A16S probably benign Het
Tmtc1 T C 6: 148,262,883 E584G probably damaging Het
Trank1 C A 9: 111,364,788 H627N probably damaging Het
Trio T C 15: 27,851,945 D820G possibly damaging Het
Trpt1 T A 19: 6,998,084 N98K probably damaging Het
Ube4b A T 4: 149,344,612 F857I probably damaging Het
Vmn2r45 A G 7: 8,472,022 V669A probably damaging Het
Vmn2r71 A G 7: 85,624,473 I832V probably damaging Het
Zbtb20 T A 16: 43,609,612 probably null Het
Zfyve9 A C 4: 108,718,603 M427R probably benign Het
Zfyve9 A T 4: 108,719,303 F194I possibly damaging Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
R7673:Hsh2d UTSW 8 72200511 missense probably benign 0.15
R7911:Hsh2d UTSW 8 72196804 missense probably damaging 1.00
R7992:Hsh2d UTSW 8 72196804 missense probably damaging 1.00
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTGTTCCAGGCTTCTGAAAG -3'
(R):5'- AGGCTTTGACCCCTGAGAATG -3'

Sequencing Primer
(F):5'- ACTGTGGAAGAACCTGAG -3'
(R):5'- GAGAATGCCTTCCTCCAGCTG -3'
Posted On2014-09-17