Incidental Mutation 'R2050:Bace2'
ID 226367
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 040057-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R2050 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 97213336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 100 (C100S)
Ref Sequence ENSEMBL: ENSMUSP00000156270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275] [ENSMUST00000231664]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047275
AA Change: C229S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: C229S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231664
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231783
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 G T 10: 126,916,130 (GRCm39) E214* probably null Het
Angpt2 G T 8: 18,755,673 (GRCm39) P265T probably benign Het
Apc2 C A 10: 80,143,443 (GRCm39) probably null Het
Arpc1b C T 5: 145,062,729 (GRCm39) P250S probably damaging Het
Atxn10 T G 15: 85,249,513 (GRCm39) V115G probably benign Het
Bpifb9b T C 2: 154,151,524 (GRCm39) S82P possibly damaging Het
Cacna1g A G 11: 94,300,300 (GRCm39) S2157P probably damaging Het
Cacnb4 T A 2: 52,359,598 (GRCm39) I104L probably damaging Het
Ccdc121 T C 5: 31,643,402 (GRCm39) I44T possibly damaging Het
Cdh6 T A 15: 13,057,587 (GRCm39) M245L probably benign Het
Celsr1 A C 15: 85,914,748 (GRCm39) V1075G probably benign Het
Cfap61 T C 2: 145,987,393 (GRCm39) F1065L probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 T C 8: 72,070,330 (GRCm39) probably null Het
Ctnnal1 A T 4: 56,835,350 (GRCm39) V309D probably benign Het
D7Ertd443e T A 7: 133,868,527 (GRCm39) E659D probably damaging Het
Dab2 T C 15: 6,464,696 (GRCm39) Y516H possibly damaging Het
Dnah14 T C 1: 181,580,127 (GRCm39) L3099P probably damaging Het
Frem3 A G 8: 81,341,520 (GRCm39) E1271G probably damaging Het
Grap2 A G 15: 80,530,444 (GRCm39) H188R probably benign Het
Grin2c T C 11: 115,148,245 (GRCm39) D344G possibly damaging Het
Hmcn2 T C 2: 31,225,448 (GRCm39) M119T probably damaging Het
Hsd11b2 A G 8: 106,249,992 (GRCm39) I368V probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifit1bl2 T A 19: 34,596,870 (GRCm39) N249Y possibly damaging Het
Igsf8 T A 1: 172,146,432 (GRCm39) Y36N probably damaging Het
Lrp12 G A 15: 39,735,985 (GRCm39) S649L probably damaging Het
Map2 T C 1: 66,453,473 (GRCm39) S788P probably damaging Het
Mast4 T C 13: 102,887,917 (GRCm39) D1164G probably damaging Het
Mcm9 A G 10: 53,488,921 (GRCm39) probably null Het
Myo5a G A 9: 75,054,156 (GRCm39) E355K probably benign Het
Myo9b T A 8: 71,743,194 (GRCm39) V85E probably damaging Het
Nbeal1 G A 1: 60,332,123 (GRCm39) probably null Het
Nlrx1 A T 9: 44,174,077 (GRCm39) W375R probably damaging Het
Pik3c2a A G 7: 116,016,686 (GRCm39) probably null Het
Plch2 A G 4: 155,085,275 (GRCm39) M272T probably benign Het
Plk4 T A 3: 40,764,815 (GRCm39) M603K probably benign Het
Rfx7 T A 9: 72,524,748 (GRCm39) V646E probably benign Het
Slc28a2b T C 2: 122,353,349 (GRCm39) S510P probably benign Het
Slc9a1 A G 4: 133,143,645 (GRCm39) H377R probably benign Het
Snrnp70 A C 7: 45,036,724 (GRCm39) Y61* probably null Het
Spatc1l T C 10: 76,399,892 (GRCm39) L138P probably damaging Het
Spink5 T C 18: 44,140,825 (GRCm39) probably null Het
Sptan1 T A 2: 29,892,250 (GRCm39) S1055T probably benign Het
Tas2r104 T A 6: 131,662,083 (GRCm39) M209L probably damaging Het
Tdrd12 C T 7: 35,228,672 (GRCm39) V17I probably damaging Het
Tmem129 C A 5: 33,815,126 (GRCm39) A16S probably benign Het
Tmtc1 T C 6: 148,164,381 (GRCm39) E584G probably damaging Het
Trank1 C A 9: 111,193,856 (GRCm39) H627N probably damaging Het
Trio T C 15: 27,852,031 (GRCm39) D820G possibly damaging Het
Trpt1 T A 19: 6,975,452 (GRCm39) N98K probably damaging Het
Ube4b A T 4: 149,429,069 (GRCm39) F857I probably damaging Het
Vmn2r45 A G 7: 8,475,021 (GRCm39) V669A probably damaging Het
Vmn2r71 A G 7: 85,273,681 (GRCm39) I832V probably damaging Het
Zbtb20 T A 16: 43,429,975 (GRCm39) probably null Het
Zfyve9 A C 4: 108,575,800 (GRCm39) M427R probably benign Het
Zfyve9 A T 4: 108,576,500 (GRCm39) F194I possibly damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCATAGCTGTTTTCAAGCATGTG -3'
(R):5'- CCATGTGGGATCTAACAGGACC -3'

Sequencing Primer
(F):5'- CAAGCATGTGTGTTGATTAACCATG -3'
(R):5'- GTGGGATCTAACAGGACCTATATTAG -3'
Posted On 2014-09-17