Incidental Mutation 'R2051:Ryr3'
ID 226383
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Name ryanodine receptor 3
Synonyms calcium release channel isoform 3
MMRRC Submission 040058-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R2051 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 112461700-113047441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112586986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 2666 (Y2666F)
Ref Sequence ENSEMBL: ENSMUSP00000147196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080673
AA Change: Y2666F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: Y2666F

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091818
AA Change: Y2686F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: Y2686F

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134358
AA Change: Y2666F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208151
AA Change: Y2666F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208290
AA Change: Y2666F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,447 (GRCm39) T98M probably damaging Het
4932414N04Rik G T 2: 68,541,392 (GRCm39) K10N possibly damaging Het
Aadat T A 8: 60,960,173 (GRCm39) S40T probably benign Het
Abca13 A G 11: 9,278,098 (GRCm39) I3093V probably benign Het
Acacb A T 5: 114,383,951 (GRCm39) Q2160L probably damaging Het
Acp6 G T 3: 97,075,333 (GRCm39) S189I probably benign Het
Actr5 A T 2: 158,474,213 (GRCm39) M339L probably benign Het
Adcy1 A T 11: 7,111,885 (GRCm39) K917* probably null Het
Adgrg5 C T 8: 95,668,695 (GRCm39) R504C probably benign Het
Ago1 T C 4: 126,354,246 (GRCm39) H188R probably benign Het
Akap9 T A 5: 4,025,685 (GRCm39) C23* probably null Het
Ank3 T C 10: 69,733,920 (GRCm39) I728T probably damaging Het
Ankrd50 A G 3: 38,508,642 (GRCm39) S1242P probably benign Het
Arhgap29 G A 3: 121,775,509 (GRCm39) R84H probably benign Het
Arhgef10 A G 8: 14,995,320 (GRCm39) D7G probably null Het
Arid4b A G 13: 14,362,230 (GRCm39) E898G probably damaging Het
Atrnl1 A G 19: 57,680,281 (GRCm39) N727S probably benign Het
Baalc G T 15: 38,796,629 (GRCm39) probably benign Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Chpf2 G T 5: 24,796,274 (GRCm39) V407L probably benign Het
Chrnb3 C A 8: 27,876,839 (GRCm39) N84K probably damaging Het
Cnot1 A G 8: 96,451,221 (GRCm39) F2171L possibly damaging Het
Csmd3 C T 15: 48,485,389 (GRCm39) probably null Het
Cux1 T A 5: 136,361,512 (GRCm39) Q138L probably damaging Het
Cyp2c65 A G 19: 39,070,675 (GRCm39) N286S probably benign Het
Dclre1b T C 3: 103,716,356 (GRCm39) S17G possibly damaging Het
Dlgap5 A G 14: 47,648,941 (GRCm39) S221P probably benign Het
Dnah1 T G 14: 31,001,080 (GRCm39) T2422P probably damaging Het
Enpp1 A G 10: 24,587,702 (GRCm39) probably null Het
Erbb2 T C 11: 98,310,998 (GRCm39) C53R probably damaging Het
Exoc8 A G 8: 125,622,219 (GRCm39) V716A probably benign Het
Fam193a T A 5: 34,619,494 (GRCm39) D766E probably benign Het
Fbxo43 C A 15: 36,162,278 (GRCm39) G310W probably damaging Het
Fcgbp C T 7: 27,819,785 (GRCm39) T2504I probably damaging Het
Fnbp4 C T 2: 90,587,876 (GRCm39) P418L probably benign Het
Gjd2 T C 2: 113,841,539 (GRCm39) T313A probably damaging Het
Gm12695 T A 4: 96,658,008 (GRCm39) R54W probably damaging Het
Gm128 T C 3: 95,148,051 (GRCm39) D81G possibly damaging Het
Gm21834 A G 17: 58,048,763 (GRCm39) V151A possibly damaging Het
Grhl1 T A 12: 24,636,151 (GRCm39) probably null Het
Hcn1 C T 13: 118,112,619 (GRCm39) T861I probably damaging Het
Herc6 C A 6: 57,602,961 (GRCm39) Q547K probably benign Het
Iqgap3 T C 3: 88,027,474 (GRCm39) L699P probably damaging Het
Kank4 T C 4: 98,668,339 (GRCm39) D36G probably damaging Het
Kcnk5 A T 14: 20,192,277 (GRCm39) S295T probably damaging Het
Krt18 T C 15: 101,937,935 (GRCm39) V144A probably benign Het
Krtap9-5 A G 11: 99,840,030 (GRCm39) I244V unknown Het
Leng1 T G 7: 3,668,400 (GRCm39) N16T probably damaging Het
Lss A G 10: 76,367,712 (GRCm39) K15E possibly damaging Het
Mastl G T 2: 23,022,836 (GRCm39) A629E possibly damaging Het
Mavs G C 2: 131,082,370 (GRCm39) A85P possibly damaging Het
Nav3 T C 10: 109,660,536 (GRCm39) D678G probably damaging Het
Nsd3 T G 8: 26,181,116 (GRCm39) S906A probably damaging Het
Nsfl1c A G 2: 151,345,002 (GRCm39) N118S probably damaging Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or4p7 C T 2: 88,221,882 (GRCm39) T97M possibly damaging Het
Or6n1 T A 1: 173,916,785 (GRCm39) Y60N possibly damaging Het
Pax8 A G 2: 24,326,520 (GRCm39) S281P probably benign Het
Pds5b T G 5: 150,671,655 (GRCm39) I433R probably damaging Het
Peg3 T C 7: 6,715,720 (GRCm39) N117D probably damaging Het
Pfkm A T 15: 98,029,573 (GRCm39) D728V probably benign Het
Phkb T C 8: 86,776,450 (GRCm39) probably null Het
Pkp4 T C 2: 59,165,248 (GRCm39) V704A probably benign Het
Ppfia2 T A 10: 106,673,160 (GRCm39) S501T probably damaging Het
Ptpru T C 4: 131,546,398 (GRCm39) E284G possibly damaging Het
Ror1 C T 4: 100,265,065 (GRCm39) R180* probably null Het
Sec23a C A 12: 59,037,754 (GRCm39) probably null Het
Sertad3 C T 7: 27,175,694 (GRCm39) Q43* probably null Het
Setd2 C T 9: 110,379,958 (GRCm39) H1258Y probably benign Het
Sharpin A G 15: 76,232,407 (GRCm39) S177P probably benign Het
Skap1 T C 11: 96,432,289 (GRCm39) F86S possibly damaging Het
Slc8a2 T C 7: 15,874,940 (GRCm39) I396T probably damaging Het
Slc9a2 T C 1: 40,765,597 (GRCm39) F329S probably damaging Het
Slx4ip C T 2: 136,908,125 (GRCm39) L161F possibly damaging Het
Sox4 A G 13: 29,136,764 (GRCm39) S81P probably damaging Het
Ssc4d G T 5: 135,999,118 (GRCm39) S28R probably benign Het
St8sia2 C T 7: 73,592,950 (GRCm39) G369S possibly damaging Het
Swt1 T C 1: 151,248,081 (GRCm39) Y836C probably damaging Het
Taar7d A G 10: 23,903,904 (GRCm39) D262G probably benign Het
Taar8b T A 10: 23,967,212 (GRCm39) L327F probably benign Het
Tars1 A T 15: 11,393,280 (GRCm39) L138* probably null Het
Tbcd A T 11: 121,344,496 (GRCm39) D75V probably damaging Het
Tesc A G 5: 118,184,394 (GRCm39) I25V probably damaging Het
Tmem132e G T 11: 82,331,264 (GRCm39) S407I probably damaging Het
Tmem50b C A 16: 91,377,180 (GRCm39) A95S possibly damaging Het
Tnr T C 1: 159,719,603 (GRCm39) I960T probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpcn1 G C 5: 120,681,453 (GRCm39) P532A probably damaging Het
Tpsb2 T C 17: 25,585,539 (GRCm39) probably benign Het
Triobp C A 15: 78,888,740 (GRCm39) H1948Q probably damaging Het
Tshb T C 3: 102,684,857 (GRCm39) I116V probably benign Het
Ttc13 A T 8: 125,398,950 (GRCm39) probably null Het
Usp34 A T 11: 23,414,468 (GRCm39) T2804S probably damaging Het
Vmn2r18 A T 5: 151,486,016 (GRCm39) C493S possibly damaging Het
Vmn2r2 T C 3: 64,024,766 (GRCm39) K605R possibly damaging Het
Vmn2r37 T C 7: 9,220,792 (GRCm39) Y357C probably damaging Het
Zc3h6 T G 2: 128,857,538 (GRCm39) S686A possibly damaging Het
Zfp608 G A 18: 55,121,386 (GRCm39) P67L probably benign Het
Zyg11a T C 4: 108,049,244 (GRCm39) probably benign Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112,490,494 (GRCm39) missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112,493,357 (GRCm39) splice site probably benign
IGL00785:Ryr3 APN 2 112,666,448 (GRCm39) missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112,716,934 (GRCm39) missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112,559,279 (GRCm39) splice site probably benign
IGL00970:Ryr3 APN 2 112,595,021 (GRCm39) missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112,582,191 (GRCm39) splice site probably benign
IGL01105:Ryr3 APN 2 112,582,150 (GRCm39) missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112,539,418 (GRCm39) missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112,490,399 (GRCm39) missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112,502,593 (GRCm39) missense probably benign 0.20
IGL01552:Ryr3 APN 2 112,656,228 (GRCm39) missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112,603,073 (GRCm39) missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112,480,456 (GRCm39) critical splice donor site probably null
IGL01837:Ryr3 APN 2 112,631,665 (GRCm39) missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112,633,503 (GRCm39) splice site probably benign
IGL01907:Ryr3 APN 2 112,699,346 (GRCm39) splice site probably benign
IGL02005:Ryr3 APN 2 112,493,608 (GRCm39) splice site probably benign
IGL02014:Ryr3 APN 2 112,777,260 (GRCm39) missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112,779,502 (GRCm39) missense probably benign
IGL02178:Ryr3 APN 2 112,656,144 (GRCm39) missense probably benign 0.17
IGL02185:Ryr3 APN 2 112,797,548 (GRCm39) missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112,585,183 (GRCm39) splice site probably benign
IGL02200:Ryr3 APN 2 112,679,855 (GRCm39) missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112,794,701 (GRCm39) missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112,475,622 (GRCm39) missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112,664,459 (GRCm39) missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112,677,744 (GRCm39) critical splice donor site probably null
IGL02340:Ryr3 APN 2 112,777,349 (GRCm39) splice site probably benign
IGL02398:Ryr3 APN 2 112,677,767 (GRCm39) missense probably benign 0.05
IGL02407:Ryr3 APN 2 112,585,303 (GRCm39) missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112,731,250 (GRCm39) missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112,664,335 (GRCm39) missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112,512,073 (GRCm39) splice site probably benign
IGL02585:Ryr3 APN 2 112,542,648 (GRCm39) missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112,732,921 (GRCm39) critical splice donor site probably null
IGL02817:Ryr3 APN 2 112,674,968 (GRCm39) critical splice donor site probably null
IGL02861:Ryr3 APN 2 112,483,186 (GRCm39) missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112,498,465 (GRCm39) missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112,630,392 (GRCm39) missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112,506,319 (GRCm39) splice site probably benign
IGL03137:Ryr3 APN 2 112,740,742 (GRCm39) missense probably benign
IGL03166:Ryr3 APN 2 112,471,457 (GRCm39) nonsense probably null
IGL03177:Ryr3 APN 2 112,859,016 (GRCm39) missense probably benign 0.39
IGL03205:Ryr3 APN 2 112,462,487 (GRCm39) missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112,784,681 (GRCm39) nonsense probably null
IGL03249:Ryr3 APN 2 112,471,001 (GRCm39) missense probably benign 0.32
IGL03370:Ryr3 APN 2 112,586,944 (GRCm39) missense possibly damaging 0.69
intruder UTSW 2 112,502,591 (GRCm39) nonsense probably null
usurper UTSW 2 112,630,367 (GRCm39) missense probably damaging 1.00
ANU74:Ryr3 UTSW 2 112,661,575 (GRCm39) critical splice acceptor site probably null
BB006:Ryr3 UTSW 2 112,664,533 (GRCm39) missense probably benign 0.00
BB016:Ryr3 UTSW 2 112,664,533 (GRCm39) missense probably benign 0.00
F5426:Ryr3 UTSW 2 112,596,683 (GRCm39) splice site probably benign
PIT4494001:Ryr3 UTSW 2 112,672,221 (GRCm39) missense probably damaging 0.99
R0022:Ryr3 UTSW 2 112,471,011 (GRCm39) missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112,471,011 (GRCm39) missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112,699,420 (GRCm39) missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112,699,420 (GRCm39) missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112,690,108 (GRCm39) missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112,630,400 (GRCm39) missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112,630,400 (GRCm39) missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112,731,376 (GRCm39) missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112,731,376 (GRCm39) missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112,633,510 (GRCm39) missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112,517,155 (GRCm39) missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112,477,468 (GRCm39) splice site probably benign
R0306:Ryr3 UTSW 2 112,606,000 (GRCm39) critical splice donor site probably null
R0445:Ryr3 UTSW 2 112,696,399 (GRCm39) missense probably benign 0.16
R0463:Ryr3 UTSW 2 112,492,046 (GRCm39) missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112,508,826 (GRCm39) missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112,492,900 (GRCm39) missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112,478,651 (GRCm39) splice site probably benign
R0735:Ryr3 UTSW 2 112,563,327 (GRCm39) missense probably benign 0.11
R0783:Ryr3 UTSW 2 112,586,672 (GRCm39) splice site probably benign
R0789:Ryr3 UTSW 2 112,611,318 (GRCm39) splice site probably null
R0835:Ryr3 UTSW 2 112,480,483 (GRCm39) missense probably benign 0.16
R0879:Ryr3 UTSW 2 112,860,588 (GRCm39) missense probably benign 0.02
R0924:Ryr3 UTSW 2 112,672,178 (GRCm39) missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112,672,178 (GRCm39) missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112,484,047 (GRCm39) missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112,699,453 (GRCm39) missense probably benign 0.42
R1169:Ryr3 UTSW 2 112,563,359 (GRCm39) missense probably benign 0.01
R1170:Ryr3 UTSW 2 112,777,332 (GRCm39) missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112,794,725 (GRCm39) missense probably benign 0.00
R1187:Ryr3 UTSW 2 112,788,521 (GRCm39) missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112,475,630 (GRCm39) missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112,610,308 (GRCm39) missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112,581,148 (GRCm39) missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112,664,546 (GRCm39) missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112,664,546 (GRCm39) missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112,475,604 (GRCm39) missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112,588,046 (GRCm39) missense probably benign 0.18
R1467:Ryr3 UTSW 2 112,583,347 (GRCm39) splice site probably benign
R1470:Ryr3 UTSW 2 112,483,352 (GRCm39) missense probably benign
R1470:Ryr3 UTSW 2 112,483,352 (GRCm39) missense probably benign
R1474:Ryr3 UTSW 2 112,740,307 (GRCm39) missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112,466,867 (GRCm39) splice site probably benign
R1513:Ryr3 UTSW 2 112,539,542 (GRCm39) nonsense probably null
R1524:Ryr3 UTSW 2 112,699,427 (GRCm39) missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112,508,435 (GRCm39) missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112,492,002 (GRCm39) missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112,483,850 (GRCm39) missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112,731,178 (GRCm39) missense probably damaging 1.00
R1662:Ryr3 UTSW 2 112,539,618 (GRCm39) missense probably damaging 0.99
R1764:Ryr3 UTSW 2 112,690,805 (GRCm39) missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112,582,113 (GRCm39) critical splice donor site probably null
R1776:Ryr3 UTSW 2 112,787,598 (GRCm39) missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112,697,637 (GRCm39) missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112,581,165 (GRCm39) missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112,560,673 (GRCm39) missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112,539,482 (GRCm39) missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112,624,812 (GRCm39) missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112,484,837 (GRCm39) missense probably null 0.93
R2018:Ryr3 UTSW 2 112,611,410 (GRCm39) missense probably benign 0.24
R2019:Ryr3 UTSW 2 112,611,410 (GRCm39) missense probably benign 0.24
R2029:Ryr3 UTSW 2 112,477,361 (GRCm39) missense possibly damaging 0.82
R2060:Ryr3 UTSW 2 112,784,709 (GRCm39) missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112,493,349 (GRCm39) missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112,777,302 (GRCm39) missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112,468,474 (GRCm39) missense probably damaging 1.00
R2129:Ryr3 UTSW 2 112,508,715 (GRCm39) splice site probably benign
R2140:Ryr3 UTSW 2 112,705,493 (GRCm39) missense probably benign 0.01
R2176:Ryr3 UTSW 2 112,496,680 (GRCm39) missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112,631,737 (GRCm39) missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112,479,664 (GRCm39) missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112,479,664 (GRCm39) missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112,516,973 (GRCm39) missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112,506,249 (GRCm39) missense probably benign 0.18
R2568:Ryr3 UTSW 2 112,506,219 (GRCm39) missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112,470,626 (GRCm39) missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112,486,876 (GRCm39) missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112,582,132 (GRCm39) missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112,585,258 (GRCm39) missense probably benign
R3909:Ryr3 UTSW 2 112,466,953 (GRCm39) missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112,672,218 (GRCm39) missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 112,859,048 (GRCm39) splice site probably benign
R3927:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112,506,182 (GRCm39) missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112,731,253 (GRCm39) missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112,506,218 (GRCm39) missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112,757,328 (GRCm39) splice site probably null
R4156:Ryr3 UTSW 2 112,484,020 (GRCm39) missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112,624,815 (GRCm39) missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112,740,752 (GRCm39) missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112,777,189 (GRCm39) missense probably benign 0.01
R4409:Ryr3 UTSW 2 112,560,653 (GRCm39) missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112,661,569 (GRCm39) missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112,483,447 (GRCm39) missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112,483,966 (GRCm39) missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112,585,519 (GRCm39) splice site probably null
R4589:Ryr3 UTSW 2 112,705,478 (GRCm39) missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112,483,108 (GRCm39) missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112,826,900 (GRCm39) intron probably benign
R4710:Ryr3 UTSW 2 112,596,646 (GRCm39) missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112,740,847 (GRCm39) missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112,633,613 (GRCm39) missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112,794,750 (GRCm39) missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112,794,750 (GRCm39) missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112,587,984 (GRCm39) missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112,563,376 (GRCm39) critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112,742,581 (GRCm39) missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112,483,090 (GRCm39) missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112,478,718 (GRCm39) missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112,738,807 (GRCm39) missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112,661,530 (GRCm39) missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112,666,602 (GRCm39) missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112,740,318 (GRCm39) missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112,466,122 (GRCm39) missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112,470,516 (GRCm39) missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112,661,504 (GRCm39) missense probably benign 0.00
R5112:Ryr3 UTSW 2 112,733,010 (GRCm39) missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112,477,272 (GRCm39) missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112,501,005 (GRCm39) missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112,588,012 (GRCm39) missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112,585,495 (GRCm39) missense probably damaging 1.00
R5206:Ryr3 UTSW 2 112,675,056 (GRCm39) missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112,548,347 (GRCm39) missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112,483,558 (GRCm39) missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112,733,038 (GRCm39) missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112,664,470 (GRCm39) missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112,606,186 (GRCm39) splice site probably null
R5434:Ryr3 UTSW 2 112,624,814 (GRCm39) missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112,560,647 (GRCm39) splice site probably null
R5501:Ryr3 UTSW 2 112,492,849 (GRCm39) missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112,585,222 (GRCm39) missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112,672,293 (GRCm39) missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112,731,329 (GRCm39) nonsense probably null
R5731:Ryr3 UTSW 2 112,471,917 (GRCm39) missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112,672,320 (GRCm39) missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112,672,320 (GRCm39) missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112,583,442 (GRCm39) missense probably benign 0.05
R5783:Ryr3 UTSW 2 112,483,343 (GRCm39) missense probably benign 0.06
R5799:Ryr3 UTSW 2 112,516,925 (GRCm39) missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112,690,076 (GRCm39) missense probably damaging 1.00
R5883:Ryr3 UTSW 2 112,860,637 (GRCm39) intron probably benign
R5911:Ryr3 UTSW 2 112,738,832 (GRCm39) missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112,477,394 (GRCm39) missense probably benign 0.22
R5972:Ryr3 UTSW 2 112,664,409 (GRCm39) missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112,502,614 (GRCm39) missense probably benign 0.00
R6084:Ryr3 UTSW 2 112,738,838 (GRCm39) missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112,465,741 (GRCm39) missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112,588,015 (GRCm39) missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112,784,639 (GRCm39) critical splice donor site probably null
R6157:Ryr3 UTSW 2 112,672,244 (GRCm39) missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112,490,449 (GRCm39) missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112,490,449 (GRCm39) missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112,486,889 (GRCm39) missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112,462,530 (GRCm39) missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112,506,278 (GRCm39) missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112,490,413 (GRCm39) missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112,697,723 (GRCm39) missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112,583,433 (GRCm39) missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112,482,955 (GRCm39) missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112,777,251 (GRCm39) missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112,788,520 (GRCm39) missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112,690,699 (GRCm39) missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112,661,545 (GRCm39) missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112,517,170 (GRCm39) missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112,596,656 (GRCm39) missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112,705,436 (GRCm39) missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112,583,423 (GRCm39) missense probably benign 0.00
R7037:Ryr3 UTSW 2 112,779,475 (GRCm39) nonsense probably null
R7166:Ryr3 UTSW 2 112,705,373 (GRCm39) missense probably damaging 1.00
R7172:Ryr3 UTSW 2 112,492,002 (GRCm39) missense probably damaging 1.00
R7177:Ryr3 UTSW 2 112,731,188 (GRCm39) missense probably damaging 1.00
R7188:Ryr3 UTSW 2 112,858,989 (GRCm39) missense probably damaging 1.00
R7202:Ryr3 UTSW 2 112,596,664 (GRCm39) missense probably damaging 1.00
R7228:Ryr3 UTSW 2 112,692,197 (GRCm39) missense probably damaging 1.00
R7256:Ryr3 UTSW 2 112,502,591 (GRCm39) nonsense probably null
R7293:Ryr3 UTSW 2 112,732,948 (GRCm39) missense probably benign 0.13
R7331:Ryr3 UTSW 2 112,594,010 (GRCm39) missense possibly damaging 0.80
R7380:Ryr3 UTSW 2 112,470,502 (GRCm39) missense probably damaging 1.00
R7391:Ryr3 UTSW 2 112,611,322 (GRCm39) critical splice donor site probably null
R7455:Ryr3 UTSW 2 112,559,211 (GRCm39) missense probably damaging 0.99
R7466:Ryr3 UTSW 2 112,757,302 (GRCm39) missense probably benign 0.40
R7481:Ryr3 UTSW 2 112,508,439 (GRCm39) missense possibly damaging 0.95
R7481:Ryr3 UTSW 2 112,508,438 (GRCm39) missense probably benign 0.16
R7497:Ryr3 UTSW 2 112,560,818 (GRCm39) missense probably benign 0.06
R7502:Ryr3 UTSW 2 112,542,706 (GRCm39) missense probably benign 0.00
R7505:Ryr3 UTSW 2 112,542,774 (GRCm39) missense probably damaging 0.99
R7581:Ryr3 UTSW 2 112,583,372 (GRCm39) missense probably damaging 0.99
R7606:Ryr3 UTSW 2 112,475,590 (GRCm39) nonsense probably null
R7677:Ryr3 UTSW 2 112,664,245 (GRCm39) missense probably benign
R7703:Ryr3 UTSW 2 112,690,110 (GRCm39) missense probably damaging 1.00
R7713:Ryr3 UTSW 2 112,465,691 (GRCm39) missense probably benign 0.12
R7784:Ryr3 UTSW 2 112,606,040 (GRCm39) missense probably damaging 1.00
R7831:Ryr3 UTSW 2 112,757,183 (GRCm39) missense possibly damaging 0.92
R7851:Ryr3 UTSW 2 112,508,862 (GRCm39) missense probably benign 0.05
R7873:Ryr3 UTSW 2 112,560,773 (GRCm39) missense probably benign 0.28
R7890:Ryr3 UTSW 2 112,757,257 (GRCm39) missense probably damaging 1.00
R7899:Ryr3 UTSW 2 112,477,295 (GRCm39) missense possibly damaging 0.86
R7904:Ryr3 UTSW 2 112,611,369 (GRCm39) missense probably damaging 1.00
R7929:Ryr3 UTSW 2 112,664,533 (GRCm39) missense probably benign 0.00
R7982:Ryr3 UTSW 2 112,499,594 (GRCm39) small deletion probably benign
R8018:Ryr3 UTSW 2 112,508,777 (GRCm39) missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112,705,422 (GRCm39) missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112,606,009 (GRCm39) missense probably damaging 1.00
R8095:Ryr3 UTSW 2 112,498,388 (GRCm39) critical splice donor site probably null
R8097:Ryr3 UTSW 2 112,500,615 (GRCm39) splice site probably null
R8181:Ryr3 UTSW 2 112,608,588 (GRCm39) missense probably damaging 0.98
R8276:Ryr3 UTSW 2 112,470,962 (GRCm39) missense probably damaging 1.00
R8329:Ryr3 UTSW 2 112,492,855 (GRCm39) missense possibly damaging 0.94
R8345:Ryr3 UTSW 2 112,483,270 (GRCm39) missense probably benign 0.01
R8361:Ryr3 UTSW 2 112,483,475 (GRCm39) missense probably damaging 0.98
R8421:Ryr3 UTSW 2 112,826,929 (GRCm39) missense probably benign 0.00
R8424:Ryr3 UTSW 2 112,672,239 (GRCm39) missense possibly damaging 0.91
R8471:Ryr3 UTSW 2 112,484,125 (GRCm39) missense probably damaging 1.00
R8505:Ryr3 UTSW 2 112,506,215 (GRCm39) missense probably damaging 0.98
R8535:Ryr3 UTSW 2 112,779,433 (GRCm39) critical splice donor site probably null
R8540:Ryr3 UTSW 2 112,630,367 (GRCm39) missense probably damaging 1.00
R8722:Ryr3 UTSW 2 112,603,116 (GRCm39) missense probably benign 0.12
R8818:Ryr3 UTSW 2 112,661,441 (GRCm39) missense probably damaging 1.00
R8819:Ryr3 UTSW 2 112,690,069 (GRCm39) missense probably benign 0.01
R8819:Ryr3 UTSW 2 112,466,137 (GRCm39) missense probably damaging 1.00
R8820:Ryr3 UTSW 2 112,690,069 (GRCm39) missense probably benign 0.01
R8820:Ryr3 UTSW 2 112,466,137 (GRCm39) missense probably damaging 1.00
R8852:Ryr3 UTSW 2 112,624,844 (GRCm39) missense probably damaging 1.00
R8859:Ryr3 UTSW 2 112,483,564 (GRCm39) missense probably damaging 0.98
R8896:Ryr3 UTSW 2 112,583,395 (GRCm39) nonsense probably null
R8916:Ryr3 UTSW 2 112,608,635 (GRCm39) missense probably damaging 1.00
R8935:Ryr3 UTSW 2 112,508,402 (GRCm39) missense probably benign 0.33
R8943:Ryr3 UTSW 2 112,465,669 (GRCm39) missense probably damaging 1.00
R8963:Ryr3 UTSW 2 112,667,015 (GRCm39) critical splice donor site probably null
R8974:Ryr3 UTSW 2 112,742,624 (GRCm39) missense possibly damaging 0.74
R9008:Ryr3 UTSW 2 112,465,748 (GRCm39) missense probably damaging 0.98
R9040:Ryr3 UTSW 2 112,784,731 (GRCm39) missense probably damaging 1.00
R9041:Ryr3 UTSW 2 112,787,546 (GRCm39) missense probably damaging 0.97
R9102:Ryr3 UTSW 2 112,508,906 (GRCm39) splice site probably benign
R9167:Ryr3 UTSW 2 112,664,398 (GRCm39) missense probably damaging 1.00
R9180:Ryr3 UTSW 2 112,491,981 (GRCm39) missense probably damaging 0.99
R9219:Ryr3 UTSW 2 112,742,584 (GRCm39) missense possibly damaging 0.62
R9258:Ryr3 UTSW 2 112,483,364 (GRCm39) missense probably damaging 0.99
R9300:Ryr3 UTSW 2 112,690,695 (GRCm39) missense probably benign
R9320:Ryr3 UTSW 2 112,610,336 (GRCm39) missense probably damaging 1.00
R9325:Ryr3 UTSW 2 112,479,640 (GRCm39) missense probably damaging 0.96
R9405:Ryr3 UTSW 2 112,664,612 (GRCm39) missense probably damaging 1.00
R9414:Ryr3 UTSW 2 112,501,011 (GRCm39) missense possibly damaging 0.81
R9489:Ryr3 UTSW 2 112,491,966 (GRCm39) missense probably damaging 1.00
R9522:Ryr3 UTSW 2 112,560,759 (GRCm39) missense probably benign 0.34
R9526:Ryr3 UTSW 2 112,664,270 (GRCm39) missense probably benign
R9529:Ryr3 UTSW 2 112,465,660 (GRCm39) missense possibly damaging 0.70
R9605:Ryr3 UTSW 2 112,491,966 (GRCm39) missense probably damaging 1.00
R9652:Ryr3 UTSW 2 112,635,047 (GRCm39) missense possibly damaging 0.66
R9660:Ryr3 UTSW 2 112,664,074 (GRCm39) missense probably benign
R9670:Ryr3 UTSW 2 112,560,845 (GRCm39) missense probably benign 0.28
R9673:Ryr3 UTSW 2 112,486,883 (GRCm39) missense possibly damaging 0.93
R9710:Ryr3 UTSW 2 112,633,534 (GRCm39) missense probably damaging 0.99
R9741:Ryr3 UTSW 2 112,477,271 (GRCm39) missense probably benign 0.00
R9772:Ryr3 UTSW 2 112,657,048 (GRCm39) missense probably damaging 0.96
RF010:Ryr3 UTSW 2 112,606,015 (GRCm39) missense probably damaging 0.97
RF040:Ryr3 UTSW 2 112,740,869 (GRCm39) critical splice acceptor site probably benign
RF044:Ryr3 UTSW 2 112,740,869 (GRCm39) critical splice acceptor site probably benign
X0057:Ryr3 UTSW 2 112,470,504 (GRCm39) missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112,742,647 (GRCm39) missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112,731,261 (GRCm39) missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112,559,269 (GRCm39) missense probably benign 0.01
Z1176:Ryr3 UTSW 2 112,542,719 (GRCm39) missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112,506,265 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TACCCCAGTGAGAGCTTTCCTAG -3'
(R):5'- TGCATTTTGACAATGTCCCATC -3'

Sequencing Primer
(F):5'- AGAGCTTTCCTAGATTCTTCATGG -3'
(R):5'- CATTTTGACAATGTCCCATCTTAAAC -3'
Posted On 2014-09-17