Incidental Mutation 'R2051:Zc3h6'
ID 226386
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 040058-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R2051 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 128857538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 686 (S686A)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110320
AA Change: S686A

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: S686A

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,447 (GRCm39) T98M probably damaging Het
4932414N04Rik G T 2: 68,541,392 (GRCm39) K10N possibly damaging Het
Aadat T A 8: 60,960,173 (GRCm39) S40T probably benign Het
Abca13 A G 11: 9,278,098 (GRCm39) I3093V probably benign Het
Acacb A T 5: 114,383,951 (GRCm39) Q2160L probably damaging Het
Acp6 G T 3: 97,075,333 (GRCm39) S189I probably benign Het
Actr5 A T 2: 158,474,213 (GRCm39) M339L probably benign Het
Adcy1 A T 11: 7,111,885 (GRCm39) K917* probably null Het
Adgrg5 C T 8: 95,668,695 (GRCm39) R504C probably benign Het
Ago1 T C 4: 126,354,246 (GRCm39) H188R probably benign Het
Akap9 T A 5: 4,025,685 (GRCm39) C23* probably null Het
Ank3 T C 10: 69,733,920 (GRCm39) I728T probably damaging Het
Ankrd50 A G 3: 38,508,642 (GRCm39) S1242P probably benign Het
Arhgap29 G A 3: 121,775,509 (GRCm39) R84H probably benign Het
Arhgef10 A G 8: 14,995,320 (GRCm39) D7G probably null Het
Arid4b A G 13: 14,362,230 (GRCm39) E898G probably damaging Het
Atrnl1 A G 19: 57,680,281 (GRCm39) N727S probably benign Het
Baalc G T 15: 38,796,629 (GRCm39) probably benign Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Chpf2 G T 5: 24,796,274 (GRCm39) V407L probably benign Het
Chrnb3 C A 8: 27,876,839 (GRCm39) N84K probably damaging Het
Cnot1 A G 8: 96,451,221 (GRCm39) F2171L possibly damaging Het
Csmd3 C T 15: 48,485,389 (GRCm39) probably null Het
Cux1 T A 5: 136,361,512 (GRCm39) Q138L probably damaging Het
Cyp2c65 A G 19: 39,070,675 (GRCm39) N286S probably benign Het
Dclre1b T C 3: 103,716,356 (GRCm39) S17G possibly damaging Het
Dlgap5 A G 14: 47,648,941 (GRCm39) S221P probably benign Het
Dnah1 T G 14: 31,001,080 (GRCm39) T2422P probably damaging Het
Enpp1 A G 10: 24,587,702 (GRCm39) probably null Het
Erbb2 T C 11: 98,310,998 (GRCm39) C53R probably damaging Het
Exoc8 A G 8: 125,622,219 (GRCm39) V716A probably benign Het
Fam193a T A 5: 34,619,494 (GRCm39) D766E probably benign Het
Fbxo43 C A 15: 36,162,278 (GRCm39) G310W probably damaging Het
Fcgbp C T 7: 27,819,785 (GRCm39) T2504I probably damaging Het
Fnbp4 C T 2: 90,587,876 (GRCm39) P418L probably benign Het
Gjd2 T C 2: 113,841,539 (GRCm39) T313A probably damaging Het
Gm12695 T A 4: 96,658,008 (GRCm39) R54W probably damaging Het
Gm128 T C 3: 95,148,051 (GRCm39) D81G possibly damaging Het
Gm21834 A G 17: 58,048,763 (GRCm39) V151A possibly damaging Het
Grhl1 T A 12: 24,636,151 (GRCm39) probably null Het
Hcn1 C T 13: 118,112,619 (GRCm39) T861I probably damaging Het
Herc6 C A 6: 57,602,961 (GRCm39) Q547K probably benign Het
Iqgap3 T C 3: 88,027,474 (GRCm39) L699P probably damaging Het
Kank4 T C 4: 98,668,339 (GRCm39) D36G probably damaging Het
Kcnk5 A T 14: 20,192,277 (GRCm39) S295T probably damaging Het
Krt18 T C 15: 101,937,935 (GRCm39) V144A probably benign Het
Krtap9-5 A G 11: 99,840,030 (GRCm39) I244V unknown Het
Leng1 T G 7: 3,668,400 (GRCm39) N16T probably damaging Het
Lss A G 10: 76,367,712 (GRCm39) K15E possibly damaging Het
Mastl G T 2: 23,022,836 (GRCm39) A629E possibly damaging Het
Mavs G C 2: 131,082,370 (GRCm39) A85P possibly damaging Het
Nav3 T C 10: 109,660,536 (GRCm39) D678G probably damaging Het
Nsd3 T G 8: 26,181,116 (GRCm39) S906A probably damaging Het
Nsfl1c A G 2: 151,345,002 (GRCm39) N118S probably damaging Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or4p7 C T 2: 88,221,882 (GRCm39) T97M possibly damaging Het
Or6n1 T A 1: 173,916,785 (GRCm39) Y60N possibly damaging Het
Pax8 A G 2: 24,326,520 (GRCm39) S281P probably benign Het
Pds5b T G 5: 150,671,655 (GRCm39) I433R probably damaging Het
Peg3 T C 7: 6,715,720 (GRCm39) N117D probably damaging Het
Pfkm A T 15: 98,029,573 (GRCm39) D728V probably benign Het
Phkb T C 8: 86,776,450 (GRCm39) probably null Het
Pkp4 T C 2: 59,165,248 (GRCm39) V704A probably benign Het
Ppfia2 T A 10: 106,673,160 (GRCm39) S501T probably damaging Het
Ptpru T C 4: 131,546,398 (GRCm39) E284G possibly damaging Het
Ror1 C T 4: 100,265,065 (GRCm39) R180* probably null Het
Ryr3 T A 2: 112,586,986 (GRCm39) Y2666F probably damaging Het
Sec23a C A 12: 59,037,754 (GRCm39) probably null Het
Sertad3 C T 7: 27,175,694 (GRCm39) Q43* probably null Het
Setd2 C T 9: 110,379,958 (GRCm39) H1258Y probably benign Het
Sharpin A G 15: 76,232,407 (GRCm39) S177P probably benign Het
Skap1 T C 11: 96,432,289 (GRCm39) F86S possibly damaging Het
Slc8a2 T C 7: 15,874,940 (GRCm39) I396T probably damaging Het
Slc9a2 T C 1: 40,765,597 (GRCm39) F329S probably damaging Het
Slx4ip C T 2: 136,908,125 (GRCm39) L161F possibly damaging Het
Sox4 A G 13: 29,136,764 (GRCm39) S81P probably damaging Het
Ssc4d G T 5: 135,999,118 (GRCm39) S28R probably benign Het
St8sia2 C T 7: 73,592,950 (GRCm39) G369S possibly damaging Het
Swt1 T C 1: 151,248,081 (GRCm39) Y836C probably damaging Het
Taar7d A G 10: 23,903,904 (GRCm39) D262G probably benign Het
Taar8b T A 10: 23,967,212 (GRCm39) L327F probably benign Het
Tars1 A T 15: 11,393,280 (GRCm39) L138* probably null Het
Tbcd A T 11: 121,344,496 (GRCm39) D75V probably damaging Het
Tesc A G 5: 118,184,394 (GRCm39) I25V probably damaging Het
Tmem132e G T 11: 82,331,264 (GRCm39) S407I probably damaging Het
Tmem50b C A 16: 91,377,180 (GRCm39) A95S possibly damaging Het
Tnr T C 1: 159,719,603 (GRCm39) I960T probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpcn1 G C 5: 120,681,453 (GRCm39) P532A probably damaging Het
Tpsb2 T C 17: 25,585,539 (GRCm39) probably benign Het
Triobp C A 15: 78,888,740 (GRCm39) H1948Q probably damaging Het
Tshb T C 3: 102,684,857 (GRCm39) I116V probably benign Het
Ttc13 A T 8: 125,398,950 (GRCm39) probably null Het
Usp34 A T 11: 23,414,468 (GRCm39) T2804S probably damaging Het
Vmn2r18 A T 5: 151,486,016 (GRCm39) C493S possibly damaging Het
Vmn2r2 T C 3: 64,024,766 (GRCm39) K605R possibly damaging Het
Vmn2r37 T C 7: 9,220,792 (GRCm39) Y357C probably damaging Het
Zfp608 G A 18: 55,121,386 (GRCm39) P67L probably benign Het
Zyg11a T C 4: 108,049,244 (GRCm39) probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTGCTCGTGACACAGCACAC -3'
(R):5'- TTTTAGGTACACGCACAGTTAAGG -3'

Sequencing Primer
(F):5'- TGACACAGCACACCTTGGGAG -3'
(R):5'- GTACACGCACAGTTAAGGTAAATTG -3'
Posted On 2014-09-17