Mutagenetix > Incidental Mutation

Incidental Mutation 'R0147:Naip1'

22639

Institutional Source

Beutler Lab

Gene Symbol

Naip1

Ensembl Gene

ENSMUSG00000021640

Gene Name

NLR family, apoptosis inhibitory protein 1

Synonyms

Birc1a, D13Lsd1, Naip

MMRRC Submission

038431-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0147 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100407764-100452869 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100426910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 582 (H582Q)

Ref Sequence

ENSEMBL: ENSMUSP00000152583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]

AlphaFold

Q9QWK5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022142
AA Change: H582Q

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: H582Q

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.18e-20	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	7.82e-26	SMART
AAA	462	603	1.14e-2	SMART
low complexity region	908	919	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221727

Predicted Effect

probably benign
Transcript: ENSMUST00000221943

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222155
AA Change: H582Q

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 94.5%
20x: 86.1%

Validation Efficiency

67% (88/131)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	C	T	18: 12,189,271	R594C	probably damaging	Het
A2m	T	C	6: 121,662,446		probably null	Het
Abtb2	A	G	2: 103,567,135	I137V	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Arl6	T	C	16: 59,618,790		probably benign	Het
Avl9	T	A	6: 56,736,502	D248E	probably benign	Het
Becn1	T	C	11: 101,301,736	E40G	probably damaging	Het
Bod1l	G	T	5: 41,818,697	A1758E	possibly damaging	Het
Btbd16	C	T	7: 130,779,594	T19I	probably damaging	Het
Casc3	T	A	11: 98,822,499	N246K	possibly damaging	Het
Celf1	G	T	2: 91,004,690		probably benign	Het
Chrm3	G	T	13: 9,878,744	N85K	probably damaging	Het
Cluh	T	A	11: 74,665,938	Y935N	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col6a5	T	C	9: 105,925,794	D1324G	unknown	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
D630003M21Rik	C	T	2: 158,203,067		probably benign	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dnmt3b	T	G	2: 153,661,457	N9K	possibly damaging	Het
Dock8	T	C	19: 25,119,459	L577P	probably benign	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam208a	A	G	14: 27,471,768	D975G	probably benign	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fam98c	T	A	7: 29,152,721	R340*	probably null	Het
Fbxw10	T	G	11: 62,847,481		probably null	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Gm28042	T	A	2: 120,036,463	S196T	probably benign	Het
Grid2	T	C	6: 64,533,587	Y734H	probably benign	Het
Grm6	T	A	11: 50,859,317	I466N	possibly damaging	Het
Hectd3	T	C	4: 116,997,040		probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Ip6k1	T	A	9: 108,045,894	D408E	probably damaging	Het
Irs2	A	T	8: 11,007,568	M288K	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Knop1	C	A	7: 118,845,838	R301L	probably benign	Het
Lama5	T	C	2: 180,190,406	H1714R	probably benign	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mprip	T	A	11: 59,737,073	D93E	possibly damaging	Het
Mtmr14	T	A	6: 113,260,666		probably benign	Het
Muc5ac	T	C	7: 141,811,039	S1917P	probably benign	Het
Muc6	C	T	7: 141,651,990	C75Y	probably damaging	Het
Nbeal2	G	A	9: 110,642,143	R264*	probably null	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nsmce2	T	G	15: 59,378,957	S26A	probably damaging	Het
Olfr1026	T	A	2: 85,924,018	I250N	possibly damaging	Het
Olfr601	T	C	7: 103,358,406	T263A	possibly damaging	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pax1	A	G	2: 147,373,734	S424G	probably benign	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Plxna1	C	T	6: 89,320,710	A1831T	possibly damaging	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Pygo2	T	C	3: 89,433,303	V299A	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rgs11	T	A	17: 26,207,459		probably null	Het
Rnf13	A	G	3: 57,802,468	D144G	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Sec23ip	C	T	7: 128,779,051		probably benign	Het
Slc25a26	T	A	6: 94,592,526		probably null	Het
Slc6a7	A	G	18: 61,002,111		probably benign	Het
Slco6b1	A	T	1: 96,987,837		noncoding transcript	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Spata22	T	A	11: 73,331,153	M1K	probably null	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tm9sf4	G	T	2: 153,195,313	V365L	probably benign	Het
Tmc3	T	C	7: 83,607,742	V401A	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Unc5b	A	T	10: 60,772,297	S675T	probably damaging	Het
Vmn1r217	A	G	13: 23,113,937	M265T	probably benign	Het
Vps54	T	A	11: 21,300,259	D548E	probably benign	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Zdbf2	C	T	1: 63,304,006	Q515*	probably null	Het
Zfp710	T	A	7: 80,081,973	C299*	probably null	Het

Other mutations in Naip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01115:Naip1	APN	13	100443720	critical splice acceptor site	probably null
IGL01145:Naip1	APN	13	100409121	missense	probably benign	0.00
IGL01356:Naip1	APN	13	100423214	missense	probably damaging	0.99
IGL01414:Naip1	APN	13	100409173	critical splice acceptor site	probably null
IGL01505:Naip1	APN	13	100425933	missense	probably damaging	1.00
IGL01573:Naip1	APN	13	100427382	missense	probably benign	0.03
IGL01931:Naip1	APN	13	100409032	nonsense	probably null
IGL02043:Naip1	APN	13	100426796	missense	probably benign	0.03
IGL02097:Naip1	APN	13	100425588	missense	probably benign	0.03
IGL02331:Naip1	APN	13	100426796	missense	probably benign	0.03
IGL02627:Naip1	APN	13	100425648	missense	possibly damaging	0.68
IGL02675:Naip1	APN	13	100409118	missense	probably benign
IGL02801:Naip1	APN	13	100444368	missense	probably damaging	1.00
IGL02851:Naip1	APN	13	100433262	missense	probably damaging	1.00
IGL03038:Naip1	APN	13	100437333	nonsense	probably null
IGL03399:Naip1	APN	13	100408918	missense	probably damaging	1.00
FR4340:Naip1	UTSW	13	100423076	missense	probably benign
FR4342:Naip1	UTSW	13	100425471	missense	probably benign	0.00
R0051:Naip1	UTSW	13	100411001	missense	probably damaging	0.96
R0095:Naip1	UTSW	13	100423083	missense	probably benign	0.24
R0375:Naip1	UTSW	13	100409148	missense	probably benign	0.21
R0442:Naip1	UTSW	13	100444516	missense	probably benign	0.00
R0455:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R0491:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R0614:Naip1	UTSW	13	100444200	missense	probably benign	0.00
R0785:Naip1	UTSW	13	100423076	missense	probably benign
R0785:Naip1	UTSW	13	100423085	missense	probably benign	0.00
R0787:Naip1	UTSW	13	100426096	missense	probably benign	0.22
R1081:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R1177:Naip1	UTSW	13	100427064	missense	possibly damaging	0.91
R1476:Naip1	UTSW	13	100426870	missense	probably benign	0.35
R1672:Naip1	UTSW	13	100423149	missense	probably benign	0.00
R1809:Naip1	UTSW	13	100426239	missense	probably benign
R2057:Naip1	UTSW	13	100425573	missense	probably damaging	0.96
R2182:Naip1	UTSW	13	100413680	missense	probably benign	0.01
R2395:Naip1	UTSW	13	100423106	missense	possibly damaging	0.83
R2518:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R3033:Naip1	UTSW	13	100432458	missense	probably benign	0.01
R3122:Naip1	UTSW	13	100408995	missense	probably damaging	1.00
R3439:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R4167:Naip1	UTSW	13	100444286	missense	probably benign	0.04
R4179:Naip1	UTSW	13	100426176	missense	probably damaging	0.99
R4212:Naip1	UTSW	13	100426875	splice site	probably null
R4639:Naip1	UTSW	13	100444283	missense	probably benign	0.31
R4674:Naip1	UTSW	13	100444174	missense	probably damaging	1.00
R4736:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R4740:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R4778:Naip1	UTSW	13	100426648	missense	probably damaging	1.00
R4806:Naip1	UTSW	13	100425621	missense	probably benign	0.00
R4855:Naip1	UTSW	13	100423220	splice site	probably null
R5740:Naip1	UTSW	13	100432501	critical splice acceptor site	probably null
R5797:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R5806:Naip1	UTSW	13	100444735	start codon destroyed	probably null	1.00
R5895:Naip1	UTSW	13	100423128	missense	probably benign	0.00
R5896:Naip1	UTSW	13	100423128	missense	probably benign	0.00
R6023:Naip1	UTSW	13	100426186	missense	probably benign	0.00
R6109:Naip1	UTSW	13	100427182	missense	probably damaging	1.00
R6117:Naip1	UTSW	13	100444737	start codon destroyed	probably damaging	0.99
R6133:Naip1	UTSW	13	100444643	missense	probably benign	0.10
R6241:Naip1	UTSW	13	100425661	missense	probably damaging	0.99
R6335:Naip1	UTSW	13	100426552	missense	probably damaging	1.00
R6404:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R6475:Naip1	UTSW	13	100409088	missense	probably damaging	1.00
R6508:Naip1	UTSW	13	100436465	missense	probably damaging	1.00
R6580:Naip1	UTSW	13	100444649	missense	probably damaging	0.99
R6600:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R6600:Naip1	UTSW	13	100423158	missense	probably benign	0.00
R6603:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R6603:Naip1	UTSW	13	100423158	missense	probably benign	0.00
R6633:Naip1	UTSW	13	100423076	missense	probably benign
R6633:Naip1	UTSW	13	100423085	missense	probably benign	0.00
R6720:Naip1	UTSW	13	100423077	missense	probably benign	0.00
R6805:Naip1	UTSW	13	100427341	missense	probably benign	0.04
R7043:Naip1	UTSW	13	100426914	missense	probably damaging	1.00
R7615:Naip1	UTSW	13	100425776	missense	probably benign	0.00
R7797:Naip1	UTSW	13	100444478	missense	probably damaging	1.00
R7820:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R7842:Naip1	UTSW	13	100426998	missense	probably damaging	1.00
R8117:Naip1	UTSW	13	100427001	missense	possibly damaging	0.67
R8132:Naip1	UTSW	13	100437375	missense	possibly damaging	0.84
R8177:Naip1	UTSW	13	100427403	missense	probably benign	0.00
R8203:Naip1	UTSW	13	100425820	missense	probably benign	0.02
R8283:Naip1	UTSW	13	100427187	missense	probably damaging	1.00
R8319:Naip1	UTSW	13	100429213	missense	probably benign	0.13
R8377:Naip1	UTSW	13	100425866	missense	possibly damaging	0.53
R8864:Naip1	UTSW	13	100426320	missense	possibly damaging	0.55
R8871:Naip1	UTSW	13	100443638	missense	probably damaging	1.00
R8987:Naip1	UTSW	13	100426926	missense	probably damaging	1.00
R9079:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R9275:Naip1	UTSW	13	100426176	missense	probably damaging	0.99
R9354:Naip1	UTSW	13	100427486	missense	probably benign	0.31
R9524:Naip1	UTSW	13	100426593	missense	probably benign	0.06
R9617:Naip1	UTSW	13	100433313	missense	probably benign	0.01
R9776:Naip1	UTSW	13	100423076	missense	probably benign
R9802:Naip1	UTSW	13	100426205	missense	probably benign
RF007:Naip1	UTSW	13	100426134	missense	probably benign	0.03
X0066:Naip1	UTSW	13	100437322	missense	probably damaging	1.00
Y4335:Naip1	UTSW	13	100425522	missense	probably benign	0.00
Y4336:Naip1	UTSW	13	100425522	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACCAGTCAGTACATACTGCTGCC -3'
(R):5'- TAGTTCCATCACACCAGACCAGGG -3'

Sequencing Primer
(F):5'- TACTGCTGCCACGAAGAG -3'
(R):5'- GCCAACATCATCTGTGCCC -3'

Posted On

2013-04-16