Incidental Mutation 'R2051:Dclre1b'
ID226397
Institutional Source Beutler Lab
Gene Symbol Dclre1b
Ensembl Gene ENSMUSG00000027845
Gene NameDNA cross-link repair 1B
SynonymsSNMIB, Apollo, mSNM1B
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103800605-103809444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103809040 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 17 (S17G)
Ref Sequence ENSEMBL: ENSMUSP00000121063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000047285] [ENSMUST00000063502] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect probably benign
Transcript: ENSMUST00000029435
AA Change: S17G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845
AA Change: S17G

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000047285
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076599
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106823
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106824
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106832
AA Change: S17G

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845
AA Change: S17G

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106834
AA Change: S17G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845
AA Change: S17G

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000128716
AA Change: S17G

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845
AA Change: S17G

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149374
Predicted Effect probably benign
Transcript: ENSMUST00000198752
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198835
Predicted Effect probably benign
Transcript: ENSMUST00000199710
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199723
Predicted Effect probably benign
Transcript: ENSMUST00000200377
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA interstrand cross-links prevent strand separation, thereby physically blocking transcription, replication, and segregation of DNA. DCLRE1B is one of several evolutionarily conserved genes involved in repair of interstrand cross-links (Dronkert et al., 2000 [PubMed 10848582]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryo size and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Dclre1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Dclre1b APN 3 103803126 missense probably benign
IGL01411:Dclre1b APN 3 103803323 missense probably damaging 1.00
IGL02311:Dclre1b APN 3 103808093 missense probably damaging 1.00
IGL03250:Dclre1b APN 3 103804064 unclassified probably null
IGL03410:Dclre1b APN 3 103808140 missense probably damaging 1.00
IGL03046:Dclre1b UTSW 3 103803281 missense probably benign 0.00
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R1173:Dclre1b UTSW 3 103803876 missense probably benign 0.00
R1997:Dclre1b UTSW 3 103803356 missense probably benign 0.02
R2914:Dclre1b UTSW 3 103808114 missense probably damaging 0.98
R3420:Dclre1b UTSW 3 103808096 missense probably damaging 1.00
R4247:Dclre1b UTSW 3 103804084 intron probably null
R4250:Dclre1b UTSW 3 103804084 intron probably null
R4474:Dclre1b UTSW 3 103807243 unclassified probably benign
R4866:Dclre1b UTSW 3 103808096 missense probably damaging 0.99
R5098:Dclre1b UTSW 3 103809136 unclassified probably benign
R5375:Dclre1b UTSW 3 103803974 missense probably damaging 1.00
R5796:Dclre1b UTSW 3 103807457 nonsense probably null
R5888:Dclre1b UTSW 3 103803737 missense probably damaging 1.00
R6189:Dclre1b UTSW 3 103803533 missense probably damaging 1.00
R6356:Dclre1b UTSW 3 103808155 missense probably damaging 1.00
R6443:Dclre1b UTSW 3 103803188 missense possibly damaging 0.82
R7471:Dclre1b UTSW 3 103803114 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCTCAGCGATCAAATCCC -3'
(R):5'- TTCATCCTGATCGTCCCGAG -3'

Sequencing Primer
(F):5'- CAGCCCCAATACCTGCAGG -3'
(R):5'- CTACTAATTCCGTTTCTGGGATGG -3'
Posted On2014-09-17