Mutagenetix > Incidental Mutations

Incidental Mutation 'R2051:Ptpru'

226404

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

040058-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2051 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 131819087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 284 (E284G)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]

AlphaFold

B1AUH1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030741
AA Change: E284G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: E284G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097860
AA Change: E212G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: E212G

Domain	Start	End	E-Value	Type
Pfam:MAM	1	116	4.1e-30	PFAM
IG	123	211	4.93e-3	SMART
FN3	213	296	3.79e-2	SMART
FN3	312	400	2.5e-2	SMART
FN3	416	504	3.62e-8	SMART
low complexity region	555	569	N/A	INTRINSIC
low complexity region	595	605	N/A	INTRINSIC
transmembrane domain	675	697	N/A	INTRINSIC
Blast:PTPc	736	878	3e-49	BLAST
SCOP:d1jlna_	790	886	9e-19	SMART
PDB:2C7S\|A	797	878	7e-22	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105987
AA Change: E284G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: E284G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	G	A	5: 138,564,185	T98M	probably damaging	Het
4932414N04Rik	G	T	2: 68,711,048	K10N	possibly damaging	Het
Aadat	T	A	8: 60,507,139	S40T	probably benign	Het
Abca13	A	G	11: 9,328,098	I3093V	probably benign	Het
Acacb	A	T	5: 114,245,890	Q2160L	probably damaging	Het
Acp6	G	T	3: 97,168,017	S189I	probably benign	Het
Actr5	A	T	2: 158,632,293	M339L	probably benign	Het
Adcy1	A	T	11: 7,161,885	K917*	probably null	Het
Adgrg5	C	T	8: 94,942,067	R504C	probably benign	Het
Ago1	T	C	4: 126,460,453	H188R	probably benign	Het
Akap9	T	A	5: 3,975,685	C23*	probably null	Het
Ank3	T	C	10: 69,898,090	I728T	probably damaging	Het
Ankrd50	A	G	3: 38,454,493	S1242P	probably benign	Het
Arhgap29	G	A	3: 121,981,860	R84H	probably benign	Het
Arhgef10	A	G	8: 14,945,320	D7G	probably null	Het
Arid4b	A	G	13: 14,187,645	E898G	probably damaging	Het
Atrnl1	A	G	19: 57,691,849	N727S	probably benign	Het
Baalc	G	T	15: 38,933,234		probably benign	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Chpf2	G	T	5: 24,591,276	V407L	probably benign	Het
Chrnb3	C	A	8: 27,386,811	N84K	probably damaging	Het
Cnot1	A	G	8: 95,724,593	F2171L	possibly damaging	Het
Csmd3	C	T	15: 48,621,993		probably null	Het
Cux1	T	A	5: 136,332,658	Q138L	probably damaging	Het
Cyp2c65	A	G	19: 39,082,231	N286S	probably benign	Het
Dclre1b	T	C	3: 103,809,040	S17G	possibly damaging	Het
Dlgap5	A	G	14: 47,411,484	S221P	probably benign	Het
Dnah1	T	G	14: 31,279,123	T2422P	probably damaging	Het
Enpp1	A	G	10: 24,711,804		probably null	Het
Erbb2	T	C	11: 98,420,172	C53R	probably damaging	Het
Exoc8	A	G	8: 124,895,480	V716A	probably benign	Het
Fam193a	T	A	5: 34,462,150	D766E	probably benign	Het
Fbxo43	C	A	15: 36,162,132	G310W	probably damaging	Het
Fcgbp	C	T	7: 28,120,360	T2504I	probably damaging	Het
Fnbp4	C	T	2: 90,757,532	P418L	probably benign	Het
Gjd2	T	C	2: 114,011,058	T313A	probably damaging	Het
Gm12695	T	A	4: 96,769,771	R54W	probably damaging	Het
Gm128	T	C	3: 95,240,740	D81G	possibly damaging	Het
Gm21834	A	G	17: 57,741,768	V151A	possibly damaging	Het
Grhl1	T	A	12: 24,586,152		probably null	Het
Hcn1	C	T	13: 117,976,083	T861I	probably damaging	Het
Herc6	C	A	6: 57,625,976	Q547K	probably benign	Het
Iqgap3	T	C	3: 88,120,167	L699P	probably damaging	Het
Kank4	T	C	4: 98,780,102	D36G	probably damaging	Het
Kcnk5	A	T	14: 20,142,209	S295T	probably damaging	Het
Krt18	T	C	15: 102,029,500	V144A	probably benign	Het
Krtap9-5	A	G	11: 99,949,204	I244V	unknown	Het
Leng1	T	G	7: 3,665,401	N16T	probably damaging	Het
Lss	A	G	10: 76,531,878	K15E	possibly damaging	Het
Mastl	G	T	2: 23,132,824	A629E	possibly damaging	Het
Mavs	G	C	2: 131,240,450	A85P	possibly damaging	Het
Nav3	T	C	10: 109,824,675	D678G	probably damaging	Het
Nsd3	T	G	8: 25,691,089	S906A	probably damaging	Het
Nsfl1c	A	G	2: 151,503,082	N118S	probably damaging	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1178	C	T	2: 88,391,538	T97M	possibly damaging	Het
Olfr429	T	A	1: 174,089,219	Y60N	possibly damaging	Het
Pax8	A	G	2: 24,436,508	S281P	probably benign	Het
Pds5b	T	G	5: 150,748,190	I433R	probably damaging	Het
Peg3	T	C	7: 6,712,721	N117D	probably damaging	Het
Pfkm	A	T	15: 98,131,692	D728V	probably benign	Het
Phkb	T	C	8: 86,049,821		probably null	Het
Pkp4	T	C	2: 59,334,904	V704A	probably benign	Het
Ppfia2	T	A	10: 106,837,299	S501T	probably damaging	Het
Ror1	C	T	4: 100,407,868	R180*	probably null	Het
Ryr3	T	A	2: 112,756,641	Y2666F	probably damaging	Het
Sec23a	C	A	12: 58,990,968		probably null	Het
Sertad3	C	T	7: 27,476,269	Q43*	probably null	Het
Setd2	C	T	9: 110,550,890	H1258Y	probably benign	Het
Sharpin	A	G	15: 76,348,207	S177P	probably benign	Het
Skap1	T	C	11: 96,541,463	F86S	possibly damaging	Het
Slc8a2	T	C	7: 16,141,015	I396T	probably damaging	Het
Slc9a2	T	C	1: 40,726,437	F329S	probably damaging	Het
Slx4ip	C	T	2: 137,066,205	L161F	possibly damaging	Het
Sox4	A	G	13: 28,952,781	S81P	probably damaging	Het
Ssc4d	G	T	5: 135,970,264	S28R	probably benign	Het
St8sia2	C	T	7: 73,943,202	G369S	possibly damaging	Het
Swt1	T	C	1: 151,372,330	Y836C	probably damaging	Het
Taar7d	A	G	10: 24,028,006	D262G	probably benign	Het
Taar8b	T	A	10: 24,091,314	L327F	probably benign	Het
Tars	A	T	15: 11,393,194	L138*	probably null	Het
Tbcd	A	T	11: 121,453,670	D75V	probably damaging	Het
Tesc	A	G	5: 118,046,329	I25V	probably damaging	Het
Tmem132e	G	T	11: 82,440,438	S407I	probably damaging	Het
Tmem50b	C	A	16: 91,580,292	A95S	possibly damaging	Het
Tnr	T	C	1: 159,892,033	I960T	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn1	G	C	5: 120,543,388	P532A	probably damaging	Het
Tpsb2	T	C	17: 25,366,565		probably benign	Het
Triobp	C	A	15: 79,004,540	H1948Q	probably damaging	Het
Tshb	T	C	3: 102,777,541	I116V	probably benign	Het
Ttc13	A	T	8: 124,672,211		probably null	Het
Usp34	A	T	11: 23,464,468	T2804S	probably damaging	Het
Vmn2r18	A	T	5: 151,562,551	C493S	possibly damaging	Het
Vmn2r2	T	C	3: 64,117,345	K605R	possibly damaging	Het
Vmn2r37	T	C	7: 9,217,793	Y357C	probably damaging	Het
Zc3h6	T	G	2: 129,015,618	S686A	possibly damaging	Het
Zfp608	G	A	18: 54,988,314	P67L	probably benign	Het
Zyg11a	T	C	4: 108,192,047		probably benign	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8276:Ptpru	UTSW	4	131779173	missense	probably damaging	1.00
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
R8858:Ptpru	UTSW	4	131799514	splice site	probably benign
R8911:Ptpru	UTSW	4	131776249	missense	probably damaging	0.96
R8934:Ptpru	UTSW	4	131818986	missense	probably damaging	0.98
R9031:Ptpru	UTSW	4	131788380	missense	probably damaging	1.00
R9069:Ptpru	UTSW	4	131776254	missense	possibly damaging	0.87
R9096:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9097:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9151:Ptpru	UTSW	4	131794967	missense	probably benign
R9166:Ptpru	UTSW	4	131797869	missense	probably benign	0.00
R9174:Ptpru	UTSW	4	131808435	missense	probably damaging	1.00
R9242:Ptpru	UTSW	4	131803030	missense	probably damaging	1.00
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGGTCTGCAGGTTGACAGC -3'
(R):5'- ACCTGAACAGTGTTGCCAG -3'

Sequencing Primer
(F):5'- AGGTTGACAGCGTGCAC -3'
(R):5'- CAGTGTTGCCAGGCAGAG -3'

Posted On

2014-09-17