Incidental Mutation 'R2051:Cux1'
ID 226414
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms CDP, Cutl1, Cux, Cux-1
MMRRC Submission 040058-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R2051 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 136276989-136596344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 136361512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 138 (Q138L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000177297] [ENSMUST00000176778] [ENSMUST00000176745]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000004097
AA Change: Q276L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: Q276L

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175975
AA Change: Q276L

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: Q276L

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
AA Change: Q46L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705
AA Change: Q46L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: Q265L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: Q265L

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
AA Change: Q276L

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: Q276L

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176423
AA Change: Q75L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705
AA Change: Q75L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176486
AA Change: Q138L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: Q138L

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177297
AA Change: Q276L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: Q276L

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: Q361L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: Q361L

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
AA Change: Q276L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: Q276L

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,447 (GRCm39) T98M probably damaging Het
4932414N04Rik G T 2: 68,541,392 (GRCm39) K10N possibly damaging Het
Aadat T A 8: 60,960,173 (GRCm39) S40T probably benign Het
Abca13 A G 11: 9,278,098 (GRCm39) I3093V probably benign Het
Acacb A T 5: 114,383,951 (GRCm39) Q2160L probably damaging Het
Acp6 G T 3: 97,075,333 (GRCm39) S189I probably benign Het
Actr5 A T 2: 158,474,213 (GRCm39) M339L probably benign Het
Adcy1 A T 11: 7,111,885 (GRCm39) K917* probably null Het
Adgrg5 C T 8: 95,668,695 (GRCm39) R504C probably benign Het
Ago1 T C 4: 126,354,246 (GRCm39) H188R probably benign Het
Akap9 T A 5: 4,025,685 (GRCm39) C23* probably null Het
Ank3 T C 10: 69,733,920 (GRCm39) I728T probably damaging Het
Ankrd50 A G 3: 38,508,642 (GRCm39) S1242P probably benign Het
Arhgap29 G A 3: 121,775,509 (GRCm39) R84H probably benign Het
Arhgef10 A G 8: 14,995,320 (GRCm39) D7G probably null Het
Arid4b A G 13: 14,362,230 (GRCm39) E898G probably damaging Het
Atrnl1 A G 19: 57,680,281 (GRCm39) N727S probably benign Het
Baalc G T 15: 38,796,629 (GRCm39) probably benign Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Chpf2 G T 5: 24,796,274 (GRCm39) V407L probably benign Het
Chrnb3 C A 8: 27,876,839 (GRCm39) N84K probably damaging Het
Cnot1 A G 8: 96,451,221 (GRCm39) F2171L possibly damaging Het
Csmd3 C T 15: 48,485,389 (GRCm39) probably null Het
Cyp2c65 A G 19: 39,070,675 (GRCm39) N286S probably benign Het
Dclre1b T C 3: 103,716,356 (GRCm39) S17G possibly damaging Het
Dlgap5 A G 14: 47,648,941 (GRCm39) S221P probably benign Het
Dnah1 T G 14: 31,001,080 (GRCm39) T2422P probably damaging Het
Enpp1 A G 10: 24,587,702 (GRCm39) probably null Het
Erbb2 T C 11: 98,310,998 (GRCm39) C53R probably damaging Het
Exoc8 A G 8: 125,622,219 (GRCm39) V716A probably benign Het
Fam193a T A 5: 34,619,494 (GRCm39) D766E probably benign Het
Fbxo43 C A 15: 36,162,278 (GRCm39) G310W probably damaging Het
Fcgbp C T 7: 27,819,785 (GRCm39) T2504I probably damaging Het
Fnbp4 C T 2: 90,587,876 (GRCm39) P418L probably benign Het
Gjd2 T C 2: 113,841,539 (GRCm39) T313A probably damaging Het
Gm12695 T A 4: 96,658,008 (GRCm39) R54W probably damaging Het
Gm128 T C 3: 95,148,051 (GRCm39) D81G possibly damaging Het
Gm21834 A G 17: 58,048,763 (GRCm39) V151A possibly damaging Het
Grhl1 T A 12: 24,636,151 (GRCm39) probably null Het
Hcn1 C T 13: 118,112,619 (GRCm39) T861I probably damaging Het
Herc6 C A 6: 57,602,961 (GRCm39) Q547K probably benign Het
Iqgap3 T C 3: 88,027,474 (GRCm39) L699P probably damaging Het
Kank4 T C 4: 98,668,339 (GRCm39) D36G probably damaging Het
Kcnk5 A T 14: 20,192,277 (GRCm39) S295T probably damaging Het
Krt18 T C 15: 101,937,935 (GRCm39) V144A probably benign Het
Krtap9-5 A G 11: 99,840,030 (GRCm39) I244V unknown Het
Leng1 T G 7: 3,668,400 (GRCm39) N16T probably damaging Het
Lss A G 10: 76,367,712 (GRCm39) K15E possibly damaging Het
Mastl G T 2: 23,022,836 (GRCm39) A629E possibly damaging Het
Mavs G C 2: 131,082,370 (GRCm39) A85P possibly damaging Het
Nav3 T C 10: 109,660,536 (GRCm39) D678G probably damaging Het
Nsd3 T G 8: 26,181,116 (GRCm39) S906A probably damaging Het
Nsfl1c A G 2: 151,345,002 (GRCm39) N118S probably damaging Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or4p7 C T 2: 88,221,882 (GRCm39) T97M possibly damaging Het
Or6n1 T A 1: 173,916,785 (GRCm39) Y60N possibly damaging Het
Pax8 A G 2: 24,326,520 (GRCm39) S281P probably benign Het
Pds5b T G 5: 150,671,655 (GRCm39) I433R probably damaging Het
Peg3 T C 7: 6,715,720 (GRCm39) N117D probably damaging Het
Pfkm A T 15: 98,029,573 (GRCm39) D728V probably benign Het
Phkb T C 8: 86,776,450 (GRCm39) probably null Het
Pkp4 T C 2: 59,165,248 (GRCm39) V704A probably benign Het
Ppfia2 T A 10: 106,673,160 (GRCm39) S501T probably damaging Het
Ptpru T C 4: 131,546,398 (GRCm39) E284G possibly damaging Het
Ror1 C T 4: 100,265,065 (GRCm39) R180* probably null Het
Ryr3 T A 2: 112,586,986 (GRCm39) Y2666F probably damaging Het
Sec23a C A 12: 59,037,754 (GRCm39) probably null Het
Sertad3 C T 7: 27,175,694 (GRCm39) Q43* probably null Het
Setd2 C T 9: 110,379,958 (GRCm39) H1258Y probably benign Het
Sharpin A G 15: 76,232,407 (GRCm39) S177P probably benign Het
Skap1 T C 11: 96,432,289 (GRCm39) F86S possibly damaging Het
Slc8a2 T C 7: 15,874,940 (GRCm39) I396T probably damaging Het
Slc9a2 T C 1: 40,765,597 (GRCm39) F329S probably damaging Het
Slx4ip C T 2: 136,908,125 (GRCm39) L161F possibly damaging Het
Sox4 A G 13: 29,136,764 (GRCm39) S81P probably damaging Het
Ssc4d G T 5: 135,999,118 (GRCm39) S28R probably benign Het
St8sia2 C T 7: 73,592,950 (GRCm39) G369S possibly damaging Het
Swt1 T C 1: 151,248,081 (GRCm39) Y836C probably damaging Het
Taar7d A G 10: 23,903,904 (GRCm39) D262G probably benign Het
Taar8b T A 10: 23,967,212 (GRCm39) L327F probably benign Het
Tars1 A T 15: 11,393,280 (GRCm39) L138* probably null Het
Tbcd A T 11: 121,344,496 (GRCm39) D75V probably damaging Het
Tesc A G 5: 118,184,394 (GRCm39) I25V probably damaging Het
Tmem132e G T 11: 82,331,264 (GRCm39) S407I probably damaging Het
Tmem50b C A 16: 91,377,180 (GRCm39) A95S possibly damaging Het
Tnr T C 1: 159,719,603 (GRCm39) I960T probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpcn1 G C 5: 120,681,453 (GRCm39) P532A probably damaging Het
Tpsb2 T C 17: 25,585,539 (GRCm39) probably benign Het
Triobp C A 15: 78,888,740 (GRCm39) H1948Q probably damaging Het
Tshb T C 3: 102,684,857 (GRCm39) I116V probably benign Het
Ttc13 A T 8: 125,398,950 (GRCm39) probably null Het
Usp34 A T 11: 23,414,468 (GRCm39) T2804S probably damaging Het
Vmn2r18 A T 5: 151,486,016 (GRCm39) C493S possibly damaging Het
Vmn2r2 T C 3: 64,024,766 (GRCm39) K605R possibly damaging Het
Vmn2r37 T C 7: 9,220,792 (GRCm39) Y357C probably damaging Het
Zc3h6 T G 2: 128,857,538 (GRCm39) S686A possibly damaging Het
Zfp608 G A 18: 55,121,386 (GRCm39) P67L probably benign Het
Zyg11a T C 4: 108,049,244 (GRCm39) probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136,355,650 (GRCm39) missense probably damaging 1.00
IGL00966:Cux1 APN 5 136,340,345 (GRCm39) intron probably benign
IGL01129:Cux1 APN 5 136,333,572 (GRCm39) intron probably benign
IGL01885:Cux1 APN 5 136,337,301 (GRCm39) missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136,303,979 (GRCm39) missense probably benign 0.04
IGL02259:Cux1 APN 5 136,355,687 (GRCm39) missense probably damaging 1.00
IGL02666:Cux1 APN 5 136,304,169 (GRCm39) nonsense probably null
IGL02826:Cux1 APN 5 136,336,857 (GRCm39) missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136,594,379 (GRCm39) intron probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0057:Cux1 UTSW 5 136,285,136 (GRCm39) missense probably damaging 1.00
R0149:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0295:Cux1 UTSW 5 136,342,066 (GRCm39) missense probably benign 0.04
R0361:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0533:Cux1 UTSW 5 136,336,713 (GRCm39) missense probably damaging 1.00
R0630:Cux1 UTSW 5 136,315,689 (GRCm39) missense probably damaging 1.00
R0801:Cux1 UTSW 5 136,355,783 (GRCm39) missense probably damaging 0.97
R0884:Cux1 UTSW 5 136,336,689 (GRCm39) missense probably damaging 1.00
R0976:Cux1 UTSW 5 136,342,144 (GRCm39) missense probably damaging 1.00
R1073:Cux1 UTSW 5 136,281,395 (GRCm39) critical splice donor site probably null
R1222:Cux1 UTSW 5 136,304,003 (GRCm39) missense probably benign 0.18
R1518:Cux1 UTSW 5 136,337,133 (GRCm39) missense probably benign 0.29
R1686:Cux1 UTSW 5 136,304,235 (GRCm39) nonsense probably null
R1687:Cux1 UTSW 5 136,341,523 (GRCm39) missense probably damaging 1.00
R1758:Cux1 UTSW 5 136,421,176 (GRCm39) missense probably damaging 1.00
R1797:Cux1 UTSW 5 136,304,169 (GRCm39) missense probably benign 0.22
R1919:Cux1 UTSW 5 136,392,173 (GRCm39) nonsense probably null
R2339:Cux1 UTSW 5 136,315,862 (GRCm39) missense probably damaging 1.00
R3438:Cux1 UTSW 5 136,340,414 (GRCm39) missense probably damaging 0.97
R3713:Cux1 UTSW 5 136,594,397 (GRCm39) intron probably benign
R3800:Cux1 UTSW 5 136,344,887 (GRCm39) missense probably damaging 1.00
R3964:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R4135:Cux1 UTSW 5 136,336,750 (GRCm39) missense probably damaging 1.00
R4198:Cux1 UTSW 5 136,315,702 (GRCm39) missense probably damaging 1.00
R4467:Cux1 UTSW 5 136,341,576 (GRCm39) missense probably damaging 1.00
R4498:Cux1 UTSW 5 136,341,847 (GRCm39) missense probably damaging 1.00
R4622:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4623:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4651:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4652:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4658:Cux1 UTSW 5 136,279,448 (GRCm39) missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136,315,653 (GRCm39) missense probably damaging 1.00
R4704:Cux1 UTSW 5 136,278,055 (GRCm39) missense probably benign 0.01
R4867:Cux1 UTSW 5 136,303,815 (GRCm39) intron probably benign
R4965:Cux1 UTSW 5 136,340,410 (GRCm39) missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136,342,054 (GRCm39) missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136,594,295 (GRCm39) intron probably benign
R5226:Cux1 UTSW 5 136,399,027 (GRCm39) missense probably benign 0.01
R5252:Cux1 UTSW 5 136,337,151 (GRCm39) missense probably damaging 0.98
R5266:Cux1 UTSW 5 136,341,548 (GRCm39) missense probably damaging 1.00
R5399:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136,304,171 (GRCm39) missense probably benign 0.13
R5609:Cux1 UTSW 5 136,421,174 (GRCm39) missense probably damaging 1.00
R5681:Cux1 UTSW 5 136,337,038 (GRCm39) missense probably damaging 1.00
R5993:Cux1 UTSW 5 136,392,125 (GRCm39) missense probably benign 0.00
R6049:Cux1 UTSW 5 136,361,564 (GRCm39) missense probably damaging 1.00
R6290:Cux1 UTSW 5 136,340,412 (GRCm39) missense probably damaging 0.99
R6310:Cux1 UTSW 5 136,304,018 (GRCm39) missense probably benign 0.10
R6351:Cux1 UTSW 5 136,338,646 (GRCm39) missense probably damaging 1.00
R6531:Cux1 UTSW 5 136,303,973 (GRCm39) missense probably benign 0.03
R6590:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6663:Cux1 UTSW 5 136,514,701 (GRCm39) missense probably damaging 1.00
R6690:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6777:Cux1 UTSW 5 136,594,422 (GRCm39) intron probably benign
R6786:Cux1 UTSW 5 136,596,085 (GRCm39) missense probably damaging 1.00
R6817:Cux1 UTSW 5 136,402,027 (GRCm39) splice site probably null
R6989:Cux1 UTSW 5 136,308,502 (GRCm39) nonsense probably null
R7011:Cux1 UTSW 5 136,388,887 (GRCm39) missense probably damaging 1.00
R7167:Cux1 UTSW 5 136,338,895 (GRCm39) splice site probably null
R7699:Cux1 UTSW 5 136,514,593 (GRCm39) critical splice donor site probably null
R7861:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136,392,161 (GRCm39) missense probably benign 0.00
R7916:Cux1 UTSW 5 136,311,815 (GRCm39) missense probably damaging 1.00
R8023:Cux1 UTSW 5 136,402,251 (GRCm39) missense probably damaging 0.99
R8154:Cux1 UTSW 5 136,281,434 (GRCm39) missense probably damaging 1.00
R8267:Cux1 UTSW 5 136,311,853 (GRCm39) missense probably damaging 1.00
R8289:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8305:Cux1 UTSW 5 136,388,863 (GRCm39) missense probably benign 0.02
R8319:Cux1 UTSW 5 136,594,251 (GRCm39) missense probably benign 0.02
R8405:Cux1 UTSW 5 136,304,241 (GRCm39) missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136,303,944 (GRCm39) missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8671:Cux1 UTSW 5 136,279,454 (GRCm39) missense probably damaging 1.00
R8680:Cux1 UTSW 5 136,336,710 (GRCm39) missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R8738:Cux1 UTSW 5 136,402,220 (GRCm39) missense probably damaging 1.00
R8793:Cux1 UTSW 5 136,594,539 (GRCm39) missense unknown
R8897:Cux1 UTSW 5 136,315,623 (GRCm39) missense probably damaging 1.00
R8926:Cux1 UTSW 5 136,338,404 (GRCm39) intron probably benign
R8954:Cux1 UTSW 5 136,402,203 (GRCm39) nonsense probably null
R9092:Cux1 UTSW 5 136,514,671 (GRCm39) missense probably damaging 1.00
R9205:Cux1 UTSW 5 136,398,989 (GRCm39) missense probably damaging 1.00
R9550:Cux1 UTSW 5 136,340,387 (GRCm39) missense probably damaging 0.99
R9578:Cux1 UTSW 5 136,282,919 (GRCm39) critical splice donor site probably null
R9682:Cux1 UTSW 5 136,337,116 (GRCm39) missense probably benign
R9701:Cux1 UTSW 5 136,343,169 (GRCm39) missense probably damaging 0.97
R9712:Cux1 UTSW 5 136,338,673 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CCTTCCCAAGTGCTAGCTAAG -3'
(R):5'- ACAGTCAGTCAGGCATGAATTG -3'

Sequencing Primer
(F):5'- AGCAGCAGCATTGATCTCTG -3'
(R):5'- TCAGTCAGGCATGAATTGATGAATG -3'
Posted On 2014-09-17