Mutagenetix > Incidental Mutation

Incidental Mutation 'R2051:Cux1'

226414

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

040058-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R2051 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 136332658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 138 (Q138L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004097
AA Change: Q276L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: Q276L

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148082

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175975
AA Change: Q276L

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: Q276L

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175998
AA Change: Q46L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705
AA Change: Q46L

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176172
AA Change: Q265L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: Q265L

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216
AA Change: Q276L

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: Q276L

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176423
AA Change: Q75L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705
AA Change: Q75L

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176486
AA Change: Q138L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: Q138L

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
low complexity region	429	445	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
low complexity region	525	536	N/A	INTRINSIC
CUT	552	638	5.06e-39	SMART
Blast:CUT	641	840	3e-50	BLAST
CUT	919	1007	3.31e-43	SMART
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1068	1089	N/A	INTRINSIC
CUT	1102	1188	3.78e-38	SMART
HOX	1228	1290	6.32e-15	SMART
low complexity region	1302	1317	N/A	INTRINSIC
low complexity region	1395	1457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176745
AA Change: Q276L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: Q276L

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176778
AA Change: Q361L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: Q361L

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177297
AA Change: Q276L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: Q276L

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	G	A	5: 138,564,185	T98M	probably damaging	Het
4932414N04Rik	G	T	2: 68,711,048	K10N	possibly damaging	Het
Aadat	T	A	8: 60,507,139	S40T	probably benign	Het
Abca13	A	G	11: 9,328,098	I3093V	probably benign	Het
Acacb	A	T	5: 114,245,890	Q2160L	probably damaging	Het
Acp6	G	T	3: 97,168,017	S189I	probably benign	Het
Actr5	A	T	2: 158,632,293	M339L	probably benign	Het
Adcy1	A	T	11: 7,161,885	K917*	probably null	Het
Adgrg5	C	T	8: 94,942,067	R504C	probably benign	Het
Ago1	T	C	4: 126,460,453	H188R	probably benign	Het
Akap9	T	A	5: 3,975,685	C23*	probably null	Het
Ank3	T	C	10: 69,898,090	I728T	probably damaging	Het
Ankrd50	A	G	3: 38,454,493	S1242P	probably benign	Het
Arhgap29	G	A	3: 121,981,860	R84H	probably benign	Het
Arhgef10	A	G	8: 14,945,320	D7G	probably null	Het
Arid4b	A	G	13: 14,187,645	E898G	probably damaging	Het
Atrnl1	A	G	19: 57,691,849	N727S	probably benign	Het
Baalc	G	T	15: 38,933,234		probably benign	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Chpf2	G	T	5: 24,591,276	V407L	probably benign	Het
Chrnb3	C	A	8: 27,386,811	N84K	probably damaging	Het
Cnot1	A	G	8: 95,724,593	F2171L	possibly damaging	Het
Csmd3	C	T	15: 48,621,993		probably null	Het
Cyp2c65	A	G	19: 39,082,231	N286S	probably benign	Het
Dclre1b	T	C	3: 103,809,040	S17G	possibly damaging	Het
Dlgap5	A	G	14: 47,411,484	S221P	probably benign	Het
Dnah1	T	G	14: 31,279,123	T2422P	probably damaging	Het
Enpp1	A	G	10: 24,711,804		probably null	Het
Erbb2	T	C	11: 98,420,172	C53R	probably damaging	Het
Exoc8	A	G	8: 124,895,480	V716A	probably benign	Het
Fam193a	T	A	5: 34,462,150	D766E	probably benign	Het
Fbxo43	C	A	15: 36,162,132	G310W	probably damaging	Het
Fcgbp	C	T	7: 28,120,360	T2504I	probably damaging	Het
Fnbp4	C	T	2: 90,757,532	P418L	probably benign	Het
Gjd2	T	C	2: 114,011,058	T313A	probably damaging	Het
Gm12695	T	A	4: 96,769,771	R54W	probably damaging	Het
Gm128	T	C	3: 95,240,740	D81G	possibly damaging	Het
Gm21834	A	G	17: 57,741,768	V151A	possibly damaging	Het
Grhl1	T	A	12: 24,586,152		probably null	Het
Hcn1	C	T	13: 117,976,083	T861I	probably damaging	Het
Herc6	C	A	6: 57,625,976	Q547K	probably benign	Het
Iqgap3	T	C	3: 88,120,167	L699P	probably damaging	Het
Kank4	T	C	4: 98,780,102	D36G	probably damaging	Het
Kcnk5	A	T	14: 20,142,209	S295T	probably damaging	Het
Krt18	T	C	15: 102,029,500	V144A	probably benign	Het
Krtap9-5	A	G	11: 99,949,204	I244V	unknown	Het
Leng1	T	G	7: 3,665,401	N16T	probably damaging	Het
Lss	A	G	10: 76,531,878	K15E	possibly damaging	Het
Mastl	G	T	2: 23,132,824	A629E	possibly damaging	Het
Mavs	G	C	2: 131,240,450	A85P	possibly damaging	Het
Nav3	T	C	10: 109,824,675	D678G	probably damaging	Het
Nsd3	T	G	8: 25,691,089	S906A	probably damaging	Het
Nsfl1c	A	G	2: 151,503,082	N118S	probably damaging	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1178	C	T	2: 88,391,538	T97M	possibly damaging	Het
Olfr429	T	A	1: 174,089,219	Y60N	possibly damaging	Het
Pax8	A	G	2: 24,436,508	S281P	probably benign	Het
Pds5b	T	G	5: 150,748,190	I433R	probably damaging	Het
Peg3	T	C	7: 6,712,721	N117D	probably damaging	Het
Pfkm	A	T	15: 98,131,692	D728V	probably benign	Het
Phkb	T	C	8: 86,049,821		probably null	Het
Pkp4	T	C	2: 59,334,904	V704A	probably benign	Het
Ppfia2	T	A	10: 106,837,299	S501T	probably damaging	Het
Ptpru	T	C	4: 131,819,087	E284G	possibly damaging	Het
Ror1	C	T	4: 100,407,868	R180*	probably null	Het
Ryr3	T	A	2: 112,756,641	Y2666F	probably damaging	Het
Sec23a	C	A	12: 58,990,968		probably null	Het
Sertad3	C	T	7: 27,476,269	Q43*	probably null	Het
Setd2	C	T	9: 110,550,890	H1258Y	probably benign	Het
Sharpin	A	G	15: 76,348,207	S177P	probably benign	Het
Skap1	T	C	11: 96,541,463	F86S	possibly damaging	Het
Slc8a2	T	C	7: 16,141,015	I396T	probably damaging	Het
Slc9a2	T	C	1: 40,726,437	F329S	probably damaging	Het
Slx4ip	C	T	2: 137,066,205	L161F	possibly damaging	Het
Sox4	A	G	13: 28,952,781	S81P	probably damaging	Het
Ssc4d	G	T	5: 135,970,264	S28R	probably benign	Het
St8sia2	C	T	7: 73,943,202	G369S	possibly damaging	Het
Swt1	T	C	1: 151,372,330	Y836C	probably damaging	Het
Taar7d	A	G	10: 24,028,006	D262G	probably benign	Het
Taar8b	T	A	10: 24,091,314	L327F	probably benign	Het
Tars	A	T	15: 11,393,194	L138*	probably null	Het
Tbcd	A	T	11: 121,453,670	D75V	probably damaging	Het
Tesc	A	G	5: 118,046,329	I25V	probably damaging	Het
Tmem132e	G	T	11: 82,440,438	S407I	probably damaging	Het
Tmem50b	C	A	16: 91,580,292	A95S	possibly damaging	Het
Tnr	T	C	1: 159,892,033	I960T	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn1	G	C	5: 120,543,388	P532A	probably damaging	Het
Tpsb2	T	C	17: 25,366,565		probably benign	Het
Triobp	C	A	15: 79,004,540	H1948Q	probably damaging	Het
Tshb	T	C	3: 102,777,541	I116V	probably benign	Het
Ttc13	A	T	8: 124,672,211		probably null	Het
Usp34	A	T	11: 23,464,468	T2804S	probably damaging	Het
Vmn2r18	A	T	5: 151,562,551	C493S	possibly damaging	Het
Vmn2r2	T	C	3: 64,117,345	K605R	possibly damaging	Het
Vmn2r37	T	C	7: 9,217,793	Y357C	probably damaging	Het
Zc3h6	T	G	2: 129,015,618	S686A	possibly damaging	Het
Zfp608	G	A	18: 54,988,314	P67L	probably benign	Het
Zyg11a	T	C	4: 108,192,047		probably benign	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8671:Cux1	UTSW	5	136250600	missense	probably damaging	1.00
R8680:Cux1	UTSW	5	136307856	missense	possibly damaging	0.46
R8737:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R8738:Cux1	UTSW	5	136373366	missense	probably damaging	1.00
R8793:Cux1	UTSW	5	136565685	missense	unknown
R8897:Cux1	UTSW	5	136286769	missense	probably damaging	1.00
R8926:Cux1	UTSW	5	136309550	intron	probably benign
R8954:Cux1	UTSW	5	136373349	nonsense	probably null
R9092:Cux1	UTSW	5	136485817	missense	probably damaging	1.00
R9205:Cux1	UTSW	5	136370135	missense	probably damaging	1.00
R9550:Cux1	UTSW	5	136311533	missense	probably damaging	0.99
R9578:Cux1	UTSW	5	136254065	critical splice donor site	probably null
R9682:Cux1	UTSW	5	136308262	missense	probably benign
R9701:Cux1	UTSW	5	136314315	missense	probably damaging	0.97
R9712:Cux1	UTSW	5	136309819	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CCTTCCCAAGTGCTAGCTAAG -3'
(R):5'- ACAGTCAGTCAGGCATGAATTG -3'

Sequencing Primer
(F):5'- AGCAGCAGCATTGATCTCTG -3'
(R):5'- TCAGTCAGGCATGAATTGATGAATG -3'

Posted On

2014-09-17