Mutagenetix > Incidental Mutation

Incidental Mutation 'R2051:St8sia2'

226428

Institutional Source

Beutler Lab

Gene Symbol

St8sia2

Ensembl Gene

ENSMUSG00000025789

Gene Name

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2

Synonyms

Siat8b, ST8SiaII

MMRRC Submission

040058-MU

Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R2051 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73939119-74013690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 73943202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 369 (G369S)

Ref Sequence

ENSEMBL: ENSMUSP00000026896 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026896]

AlphaFold

O35696

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026896
AA Change: G369S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: G369S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	25	39	N/A	INTRINSIC
Pfam:Glyco_transf_29	109	369	2.7e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205875

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	G	A	5: 138,564,185	T98M	probably damaging	Het
4932414N04Rik	G	T	2: 68,711,048	K10N	possibly damaging	Het
Aadat	T	A	8: 60,507,139	S40T	probably benign	Het
Abca13	A	G	11: 9,328,098	I3093V	probably benign	Het
Acacb	A	T	5: 114,245,890	Q2160L	probably damaging	Het
Acp6	G	T	3: 97,168,017	S189I	probably benign	Het
Actr5	A	T	2: 158,632,293	M339L	probably benign	Het
Adcy1	A	T	11: 7,161,885	K917*	probably null	Het
Adgrg5	C	T	8: 94,942,067	R504C	probably benign	Het
Ago1	T	C	4: 126,460,453	H188R	probably benign	Het
Akap9	T	A	5: 3,975,685	C23*	probably null	Het
Ank3	T	C	10: 69,898,090	I728T	probably damaging	Het
Ankrd50	A	G	3: 38,454,493	S1242P	probably benign	Het
Arhgap29	G	A	3: 121,981,860	R84H	probably benign	Het
Arhgef10	A	G	8: 14,945,320	D7G	probably null	Het
Arid4b	A	G	13: 14,187,645	E898G	probably damaging	Het
Atrnl1	A	G	19: 57,691,849	N727S	probably benign	Het
Baalc	G	T	15: 38,933,234		probably benign	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Chpf2	G	T	5: 24,591,276	V407L	probably benign	Het
Chrnb3	C	A	8: 27,386,811	N84K	probably damaging	Het
Cnot1	A	G	8: 95,724,593	F2171L	possibly damaging	Het
Csmd3	C	T	15: 48,621,993		probably null	Het
Cux1	T	A	5: 136,332,658	Q138L	probably damaging	Het
Cyp2c65	A	G	19: 39,082,231	N286S	probably benign	Het
Dclre1b	T	C	3: 103,809,040	S17G	possibly damaging	Het
Dlgap5	A	G	14: 47,411,484	S221P	probably benign	Het
Dnah1	T	G	14: 31,279,123	T2422P	probably damaging	Het
Enpp1	A	G	10: 24,711,804		probably null	Het
Erbb2	T	C	11: 98,420,172	C53R	probably damaging	Het
Exoc8	A	G	8: 124,895,480	V716A	probably benign	Het
Fam193a	T	A	5: 34,462,150	D766E	probably benign	Het
Fbxo43	C	A	15: 36,162,132	G310W	probably damaging	Het
Fcgbp	C	T	7: 28,120,360	T2504I	probably damaging	Het
Fnbp4	C	T	2: 90,757,532	P418L	probably benign	Het
Gjd2	T	C	2: 114,011,058	T313A	probably damaging	Het
Gm12695	T	A	4: 96,769,771	R54W	probably damaging	Het
Gm128	T	C	3: 95,240,740	D81G	possibly damaging	Het
Gm21834	A	G	17: 57,741,768	V151A	possibly damaging	Het
Grhl1	T	A	12: 24,586,152		probably null	Het
Hcn1	C	T	13: 117,976,083	T861I	probably damaging	Het
Herc6	C	A	6: 57,625,976	Q547K	probably benign	Het
Iqgap3	T	C	3: 88,120,167	L699P	probably damaging	Het
Kank4	T	C	4: 98,780,102	D36G	probably damaging	Het
Kcnk5	A	T	14: 20,142,209	S295T	probably damaging	Het
Krt18	T	C	15: 102,029,500	V144A	probably benign	Het
Krtap9-5	A	G	11: 99,949,204	I244V	unknown	Het
Leng1	T	G	7: 3,665,401	N16T	probably damaging	Het
Lss	A	G	10: 76,531,878	K15E	possibly damaging	Het
Mastl	G	T	2: 23,132,824	A629E	possibly damaging	Het
Mavs	G	C	2: 131,240,450	A85P	possibly damaging	Het
Nav3	T	C	10: 109,824,675	D678G	probably damaging	Het
Nsd3	T	G	8: 25,691,089	S906A	probably damaging	Het
Nsfl1c	A	G	2: 151,503,082	N118S	probably damaging	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1178	C	T	2: 88,391,538	T97M	possibly damaging	Het
Olfr429	T	A	1: 174,089,219	Y60N	possibly damaging	Het
Pax8	A	G	2: 24,436,508	S281P	probably benign	Het
Pds5b	T	G	5: 150,748,190	I433R	probably damaging	Het
Peg3	T	C	7: 6,712,721	N117D	probably damaging	Het
Pfkm	A	T	15: 98,131,692	D728V	probably benign	Het
Phkb	T	C	8: 86,049,821		probably null	Het
Pkp4	T	C	2: 59,334,904	V704A	probably benign	Het
Ppfia2	T	A	10: 106,837,299	S501T	probably damaging	Het
Ptpru	T	C	4: 131,819,087	E284G	possibly damaging	Het
Ror1	C	T	4: 100,407,868	R180*	probably null	Het
Ryr3	T	A	2: 112,756,641	Y2666F	probably damaging	Het
Sec23a	C	A	12: 58,990,968		probably null	Het
Sertad3	C	T	7: 27,476,269	Q43*	probably null	Het
Setd2	C	T	9: 110,550,890	H1258Y	probably benign	Het
Sharpin	A	G	15: 76,348,207	S177P	probably benign	Het
Skap1	T	C	11: 96,541,463	F86S	possibly damaging	Het
Slc8a2	T	C	7: 16,141,015	I396T	probably damaging	Het
Slc9a2	T	C	1: 40,726,437	F329S	probably damaging	Het
Slx4ip	C	T	2: 137,066,205	L161F	possibly damaging	Het
Sox4	A	G	13: 28,952,781	S81P	probably damaging	Het
Ssc4d	G	T	5: 135,970,264	S28R	probably benign	Het
Swt1	T	C	1: 151,372,330	Y836C	probably damaging	Het
Taar7d	A	G	10: 24,028,006	D262G	probably benign	Het
Taar8b	T	A	10: 24,091,314	L327F	probably benign	Het
Tars	A	T	15: 11,393,194	L138*	probably null	Het
Tbcd	A	T	11: 121,453,670	D75V	probably damaging	Het
Tesc	A	G	5: 118,046,329	I25V	probably damaging	Het
Tmem132e	G	T	11: 82,440,438	S407I	probably damaging	Het
Tmem50b	C	A	16: 91,580,292	A95S	possibly damaging	Het
Tnr	T	C	1: 159,892,033	I960T	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn1	G	C	5: 120,543,388	P532A	probably damaging	Het
Tpsb2	T	C	17: 25,366,565		probably benign	Het
Triobp	C	A	15: 79,004,540	H1948Q	probably damaging	Het
Tshb	T	C	3: 102,777,541	I116V	probably benign	Het
Ttc13	A	T	8: 124,672,211		probably null	Het
Usp34	A	T	11: 23,464,468	T2804S	probably damaging	Het
Vmn2r18	A	T	5: 151,562,551	C493S	possibly damaging	Het
Vmn2r2	T	C	3: 64,117,345	K605R	possibly damaging	Het
Vmn2r37	T	C	7: 9,217,793	Y357C	probably damaging	Het
Zc3h6	T	G	2: 129,015,618	S686A	possibly damaging	Het
Zfp608	G	A	18: 54,988,314	P67L	probably benign	Het
Zyg11a	T	C	4: 108,192,047		probably benign	Het

Other mutations in St8sia2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02161:St8sia2	APN	7	73976682	missense	probably benign	0.00
IGL02261:St8sia2	APN	7	73966846	missense	probably damaging	1.00
IGL02941:St8sia2	APN	7	73976649	intron	probably benign
IGL02971:St8sia2	APN	7	73966811	missense	probably damaging	1.00
BB001:St8sia2	UTSW	7	73966952	missense	probably damaging	1.00
BB011:St8sia2	UTSW	7	73966952	missense	probably damaging	1.00
IGL03147:St8sia2	UTSW	7	73966819	missense	probably damaging	1.00
R0052:St8sia2	UTSW	7	73943290	nonsense	probably null
R0052:St8sia2	UTSW	7	73943290	nonsense	probably null
R0052:St8sia2	UTSW	7	73971952	missense	probably damaging	1.00
R0733:St8sia2	UTSW	7	73960840	missense	probably benign
R1202:St8sia2	UTSW	7	73972035	missense	probably benign	0.43
R1419:St8sia2	UTSW	7	73966994	nonsense	probably null
R1962:St8sia2	UTSW	7	73943309	missense	probably damaging	1.00
R4106:St8sia2	UTSW	7	73960761	missense	probably damaging	1.00
R4989:St8sia2	UTSW	7	73966961	missense	possibly damaging	0.75
R5541:St8sia2	UTSW	7	73966900	missense	probably benign	0.00
R5859:St8sia2	UTSW	7	73966906	missense	probably damaging	1.00
R6029:St8sia2	UTSW	7	73960710	missense	possibly damaging	0.96
R6260:St8sia2	UTSW	7	73976693	missense	possibly damaging	0.56
R6416:St8sia2	UTSW	7	73971921	missense	probably damaging	1.00
R7371:St8sia2	UTSW	7	73966927	missense	probably damaging	0.99
R7424:St8sia2	UTSW	7	73960902	missense	possibly damaging	0.66
R7763:St8sia2	UTSW	7	73943321	missense	probably damaging	1.00
R7924:St8sia2	UTSW	7	73966952	missense	probably damaging	1.00
R8688:St8sia2	UTSW	7	73943344	missense	probably damaging	1.00
R9137:St8sia2	UTSW	7	73960906	missense	probably benign	0.03
R9139:St8sia2	UTSW	7	73966765	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTAGATGAACACCACACAG -3'
(R):5'- TGCAATCAGATCTACCTTTATGGC -3'

Sequencing Primer
(F):5'- CCACACAGTTATAAATACTCAGGTC -3'
(R):5'- AGATCTACCTTTATGGCTTCTGG -3'

Posted On

2014-09-17