Incidental Mutation 'R2051:Enpp1'
ID226442
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R2051 (G1)
Quality Score171
Status Not validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 24711804 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000105520] [ENSMUST00000135846] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105520
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105520
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135846
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135846
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 intron probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCAAATGTCCTGTATTCTCTGGG -3'
(R):5'- AGCCTATTAAAGCTCGGCCC -3'

Sequencing Primer
(F):5'- TATTCTCTGGGGGAAGAGGAC -3'
(R):5'- CAGAGCGGGGCGATGGAG -3'
Posted On2014-09-17