Incidental Mutation 'R2051:Ank3'
ID 226443
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Name ankyrin 3, epithelial
Synonyms AnkG, Ankyrin-3, Ank-3, Ankyrin-G, 2900054D09Rik
MMRRC Submission 040058-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.829) question?
Stock # R2051 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 69234608-69863266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69733920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 728 (I728T)
Ref Sequence ENSEMBL: ENSMUSP00000090087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092434] [ENSMUST00000182155] [ENSMUST00000182439] [ENSMUST00000182683] [ENSMUST00000183148] [ENSMUST00000183169] [ENSMUST00000182884] [ENSMUST00000182992] [ENSMUST00000218680] [ENSMUST00000182972]
AlphaFold G5E8K5
Predicted Effect probably benign
Transcript: ENSMUST00000047061
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000054167
AA Change: I728T
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092431
AA Change: I728T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092432
AA Change: I728T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092434
AA Change: I728T
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182155
AA Change: I728T
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182439
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182474
Predicted Effect probably benign
Transcript: ENSMUST00000182683
SMART Domains Protein: ENSMUSP00000138375
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 65 82 N/A INTRINSIC
ZU5 153 257 2.75e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183148
AA Change: I728T

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183169
AA Change: I728T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182884
AA Change: I728T
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601
AA Change: I728T

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182992
AA Change: I753T

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601
AA Change: I753T

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218680
AA Change: I739T

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000182972
SMART Domains Protein: ENSMUSP00000138481
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 4 33 1.43e-5 SMART
low complexity region 61 72 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
ZU5 203 307 2.27e-58 SMART
DEATH 688 782 5.8e-33 SMART
low complexity region 1019 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,447 (GRCm39) T98M probably damaging Het
4932414N04Rik G T 2: 68,541,392 (GRCm39) K10N possibly damaging Het
Aadat T A 8: 60,960,173 (GRCm39) S40T probably benign Het
Abca13 A G 11: 9,278,098 (GRCm39) I3093V probably benign Het
Acacb A T 5: 114,383,951 (GRCm39) Q2160L probably damaging Het
Acp6 G T 3: 97,075,333 (GRCm39) S189I probably benign Het
Actr5 A T 2: 158,474,213 (GRCm39) M339L probably benign Het
Adcy1 A T 11: 7,111,885 (GRCm39) K917* probably null Het
Adgrg5 C T 8: 95,668,695 (GRCm39) R504C probably benign Het
Ago1 T C 4: 126,354,246 (GRCm39) H188R probably benign Het
Akap9 T A 5: 4,025,685 (GRCm39) C23* probably null Het
Ankrd50 A G 3: 38,508,642 (GRCm39) S1242P probably benign Het
Arhgap29 G A 3: 121,775,509 (GRCm39) R84H probably benign Het
Arhgef10 A G 8: 14,995,320 (GRCm39) D7G probably null Het
Arid4b A G 13: 14,362,230 (GRCm39) E898G probably damaging Het
Atrnl1 A G 19: 57,680,281 (GRCm39) N727S probably benign Het
Baalc G T 15: 38,796,629 (GRCm39) probably benign Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Chpf2 G T 5: 24,796,274 (GRCm39) V407L probably benign Het
Chrnb3 C A 8: 27,876,839 (GRCm39) N84K probably damaging Het
Cnot1 A G 8: 96,451,221 (GRCm39) F2171L possibly damaging Het
Csmd3 C T 15: 48,485,389 (GRCm39) probably null Het
Cux1 T A 5: 136,361,512 (GRCm39) Q138L probably damaging Het
Cyp2c65 A G 19: 39,070,675 (GRCm39) N286S probably benign Het
Dclre1b T C 3: 103,716,356 (GRCm39) S17G possibly damaging Het
Dlgap5 A G 14: 47,648,941 (GRCm39) S221P probably benign Het
Dnah1 T G 14: 31,001,080 (GRCm39) T2422P probably damaging Het
Enpp1 A G 10: 24,587,702 (GRCm39) probably null Het
Erbb2 T C 11: 98,310,998 (GRCm39) C53R probably damaging Het
Exoc8 A G 8: 125,622,219 (GRCm39) V716A probably benign Het
Fam193a T A 5: 34,619,494 (GRCm39) D766E probably benign Het
Fbxo43 C A 15: 36,162,278 (GRCm39) G310W probably damaging Het
Fcgbp C T 7: 27,819,785 (GRCm39) T2504I probably damaging Het
Fnbp4 C T 2: 90,587,876 (GRCm39) P418L probably benign Het
Gjd2 T C 2: 113,841,539 (GRCm39) T313A probably damaging Het
Gm12695 T A 4: 96,658,008 (GRCm39) R54W probably damaging Het
Gm128 T C 3: 95,148,051 (GRCm39) D81G possibly damaging Het
Gm21834 A G 17: 58,048,763 (GRCm39) V151A possibly damaging Het
Grhl1 T A 12: 24,636,151 (GRCm39) probably null Het
Hcn1 C T 13: 118,112,619 (GRCm39) T861I probably damaging Het
Herc6 C A 6: 57,602,961 (GRCm39) Q547K probably benign Het
Iqgap3 T C 3: 88,027,474 (GRCm39) L699P probably damaging Het
Kank4 T C 4: 98,668,339 (GRCm39) D36G probably damaging Het
Kcnk5 A T 14: 20,192,277 (GRCm39) S295T probably damaging Het
Krt18 T C 15: 101,937,935 (GRCm39) V144A probably benign Het
Krtap9-5 A G 11: 99,840,030 (GRCm39) I244V unknown Het
Leng1 T G 7: 3,668,400 (GRCm39) N16T probably damaging Het
Lss A G 10: 76,367,712 (GRCm39) K15E possibly damaging Het
Mastl G T 2: 23,022,836 (GRCm39) A629E possibly damaging Het
Mavs G C 2: 131,082,370 (GRCm39) A85P possibly damaging Het
Nav3 T C 10: 109,660,536 (GRCm39) D678G probably damaging Het
Nsd3 T G 8: 26,181,116 (GRCm39) S906A probably damaging Het
Nsfl1c A G 2: 151,345,002 (GRCm39) N118S probably damaging Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or4p7 C T 2: 88,221,882 (GRCm39) T97M possibly damaging Het
Or6n1 T A 1: 173,916,785 (GRCm39) Y60N possibly damaging Het
Pax8 A G 2: 24,326,520 (GRCm39) S281P probably benign Het
Pds5b T G 5: 150,671,655 (GRCm39) I433R probably damaging Het
Peg3 T C 7: 6,715,720 (GRCm39) N117D probably damaging Het
Pfkm A T 15: 98,029,573 (GRCm39) D728V probably benign Het
Phkb T C 8: 86,776,450 (GRCm39) probably null Het
Pkp4 T C 2: 59,165,248 (GRCm39) V704A probably benign Het
Ppfia2 T A 10: 106,673,160 (GRCm39) S501T probably damaging Het
Ptpru T C 4: 131,546,398 (GRCm39) E284G possibly damaging Het
Ror1 C T 4: 100,265,065 (GRCm39) R180* probably null Het
Ryr3 T A 2: 112,586,986 (GRCm39) Y2666F probably damaging Het
Sec23a C A 12: 59,037,754 (GRCm39) probably null Het
Sertad3 C T 7: 27,175,694 (GRCm39) Q43* probably null Het
Setd2 C T 9: 110,379,958 (GRCm39) H1258Y probably benign Het
Sharpin A G 15: 76,232,407 (GRCm39) S177P probably benign Het
Skap1 T C 11: 96,432,289 (GRCm39) F86S possibly damaging Het
Slc8a2 T C 7: 15,874,940 (GRCm39) I396T probably damaging Het
Slc9a2 T C 1: 40,765,597 (GRCm39) F329S probably damaging Het
Slx4ip C T 2: 136,908,125 (GRCm39) L161F possibly damaging Het
Sox4 A G 13: 29,136,764 (GRCm39) S81P probably damaging Het
Ssc4d G T 5: 135,999,118 (GRCm39) S28R probably benign Het
St8sia2 C T 7: 73,592,950 (GRCm39) G369S possibly damaging Het
Swt1 T C 1: 151,248,081 (GRCm39) Y836C probably damaging Het
Taar7d A G 10: 23,903,904 (GRCm39) D262G probably benign Het
Taar8b T A 10: 23,967,212 (GRCm39) L327F probably benign Het
Tars1 A T 15: 11,393,280 (GRCm39) L138* probably null Het
Tbcd A T 11: 121,344,496 (GRCm39) D75V probably damaging Het
Tesc A G 5: 118,184,394 (GRCm39) I25V probably damaging Het
Tmem132e G T 11: 82,331,264 (GRCm39) S407I probably damaging Het
Tmem50b C A 16: 91,377,180 (GRCm39) A95S possibly damaging Het
Tnr T C 1: 159,719,603 (GRCm39) I960T probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpcn1 G C 5: 120,681,453 (GRCm39) P532A probably damaging Het
Tpsb2 T C 17: 25,585,539 (GRCm39) probably benign Het
Triobp C A 15: 78,888,740 (GRCm39) H1948Q probably damaging Het
Tshb T C 3: 102,684,857 (GRCm39) I116V probably benign Het
Ttc13 A T 8: 125,398,950 (GRCm39) probably null Het
Usp34 A T 11: 23,414,468 (GRCm39) T2804S probably damaging Het
Vmn2r18 A T 5: 151,486,016 (GRCm39) C493S possibly damaging Het
Vmn2r2 T C 3: 64,024,766 (GRCm39) K605R possibly damaging Het
Vmn2r37 T C 7: 9,220,792 (GRCm39) Y357C probably damaging Het
Zc3h6 T G 2: 128,857,538 (GRCm39) S686A possibly damaging Het
Zfp608 G A 18: 55,121,386 (GRCm39) P67L probably benign Het
Zyg11a T C 4: 108,049,244 (GRCm39) probably benign Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69,818,035 (GRCm39) splice site probably benign
IGL00578:Ank3 APN 10 69,838,224 (GRCm39) missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69,710,663 (GRCm39) missense probably damaging 0.99
IGL01067:Ank3 APN 10 69,686,026 (GRCm39) missense probably damaging 1.00
IGL01483:Ank3 APN 10 69,710,639 (GRCm39) missense probably damaging 1.00
IGL01549:Ank3 APN 10 69,768,250 (GRCm39) missense probably damaging 1.00
IGL01576:Ank3 APN 10 69,816,121 (GRCm39) missense probably damaging 1.00
IGL01601:Ank3 APN 10 69,840,555 (GRCm39) missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69,728,324 (GRCm39) missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69,835,203 (GRCm39) missense probably damaging 1.00
IGL02159:Ank3 APN 10 69,644,722 (GRCm39) missense probably damaging 1.00
IGL02249:Ank3 APN 10 69,718,200 (GRCm39) missense probably damaging 1.00
IGL02942:Ank3 APN 10 69,809,707 (GRCm39) missense probably damaging 1.00
IGL02979:Ank3 APN 10 69,837,929 (GRCm39) missense probably benign 0.01
IGL03379:Ank3 APN 10 69,809,602 (GRCm39) missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69,828,902 (GRCm39) missense
R0011:Ank3 UTSW 10 69,815,281 (GRCm39) splice site probably benign
R0011:Ank3 UTSW 10 69,815,281 (GRCm39) splice site probably benign
R0172:Ank3 UTSW 10 69,811,888 (GRCm39) missense probably damaging 1.00
R0315:Ank3 UTSW 10 69,838,347 (GRCm39) missense probably damaging 0.98
R0480:Ank3 UTSW 10 69,715,756 (GRCm39) missense probably damaging 0.96
R0485:Ank3 UTSW 10 69,718,374 (GRCm39) missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69,718,198 (GRCm39) missense probably damaging 1.00
R1148:Ank3 UTSW 10 69,718,369 (GRCm39) missense probably damaging 1.00
R1148:Ank3 UTSW 10 69,718,369 (GRCm39) missense probably damaging 1.00
R1165:Ank3 UTSW 10 69,734,132 (GRCm39) missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69,703,290 (GRCm39) missense probably damaging 1.00
R1257:Ank3 UTSW 10 69,710,665 (GRCm39) nonsense probably null
R1300:Ank3 UTSW 10 69,840,495 (GRCm39) missense probably benign 0.03
R1391:Ank3 UTSW 10 69,370,110 (GRCm39) missense possibly damaging 0.96
R1549:Ank3 UTSW 10 69,837,812 (GRCm39) missense probably benign 0.18
R1586:Ank3 UTSW 10 69,713,708 (GRCm39) missense probably damaging 0.98
R1619:Ank3 UTSW 10 69,715,805 (GRCm39) missense probably damaging 1.00
R1643:Ank3 UTSW 10 69,720,632 (GRCm39) missense probably benign 0.00
R1874:Ank3 UTSW 10 69,733,913 (GRCm39) missense probably damaging 1.00
R1884:Ank3 UTSW 10 69,851,422 (GRCm39) missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69,658,167 (GRCm39) missense probably damaging 1.00
R1986:Ank3 UTSW 10 69,703,258 (GRCm39) missense probably damaging 1.00
R2273:Ank3 UTSW 10 69,786,772 (GRCm39) splice site probably null
R2274:Ank3 UTSW 10 69,786,772 (GRCm39) splice site probably null
R2421:Ank3 UTSW 10 69,818,034 (GRCm39) splice site probably benign
R2434:Ank3 UTSW 10 69,837,948 (GRCm39) missense probably damaging 1.00
R2969:Ank3 UTSW 10 69,830,225 (GRCm39) missense probably damaging 1.00
R3426:Ank3 UTSW 10 69,542,724 (GRCm39) missense probably benign
R3885:Ank3 UTSW 10 69,734,866 (GRCm39) missense probably damaging 1.00
R3936:Ank3 UTSW 10 69,715,819 (GRCm39) nonsense probably null
R4258:Ank3 UTSW 10 69,840,592 (GRCm39) missense probably benign 0.33
R4320:Ank3 UTSW 10 69,740,076 (GRCm39) missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69,822,900 (GRCm39) missense probably damaging 0.99
R4435:Ank3 UTSW 10 69,822,900 (GRCm39) missense probably damaging 0.99
R4486:Ank3 UTSW 10 69,837,804 (GRCm39) missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69,734,086 (GRCm39) missense probably damaging 1.00
R4492:Ank3 UTSW 10 69,644,755 (GRCm39) missense probably damaging 1.00
R4508:Ank3 UTSW 10 69,728,200 (GRCm39) missense probably damaging 1.00
R4561:Ank3 UTSW 10 69,837,848 (GRCm39) missense probably damaging 0.99
R4724:Ank3 UTSW 10 69,542,688 (GRCm39) missense probably benign
R4751:Ank3 UTSW 10 69,822,036 (GRCm39) missense probably benign 0.19
R4790:Ank3 UTSW 10 69,823,981 (GRCm39) nonsense probably null
R4795:Ank3 UTSW 10 69,694,095 (GRCm39) missense probably benign 0.36
R4921:Ank3 UTSW 10 69,837,939 (GRCm39) missense probably damaging 1.00
R4932:Ank3 UTSW 10 69,734,053 (GRCm39) splice site probably null
R4935:Ank3 UTSW 10 69,812,033 (GRCm39) missense probably damaging 0.99
R4946:Ank3 UTSW 10 69,733,947 (GRCm39) missense probably damaging 1.00
R5174:Ank3 UTSW 10 69,728,209 (GRCm39) missense probably damaging 0.99
R5208:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69,822,938 (GRCm39) missense probably benign 0.00
R5255:Ank3 UTSW 10 69,721,030 (GRCm39) missense probably damaging 1.00
R5307:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5308:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69,789,306 (GRCm39) splice site probably null
R5374:Ank3 UTSW 10 69,789,306 (GRCm39) splice site probably null
R5502:Ank3 UTSW 10 69,756,291 (GRCm39) missense probably benign 0.12
R5508:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5509:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5510:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69,823,257 (GRCm39) missense probably damaging 1.00
R5664:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5665:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69,729,347 (GRCm39) missense probably damaging 1.00
R5834:Ank3 UTSW 10 69,658,087 (GRCm39) missense probably damaging 1.00
R5881:Ank3 UTSW 10 69,822,660 (GRCm39) missense probably benign 0.31
R5914:Ank3 UTSW 10 69,828,774 (GRCm39) intron probably benign
R5940:Ank3 UTSW 10 69,756,316 (GRCm39) missense probably benign 0.00
R5952:Ank3 UTSW 10 69,822,293 (GRCm39) missense probably benign 0.07
R5963:Ank3 UTSW 10 69,823,056 (GRCm39) nonsense probably null
R6075:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6076:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6077:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6081:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6092:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69,830,231 (GRCm39) missense probably damaging 0.98
R6135:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69,763,557 (GRCm39) missense probably damaging 1.00
R6248:Ank3 UTSW 10 69,809,680 (GRCm39) missense probably benign 0.10
R6249:Ank3 UTSW 10 69,658,906 (GRCm39) critical splice acceptor site probably null
R6273:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6274:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69,827,198 (GRCm39) intron probably benign
R6298:Ank3 UTSW 10 69,686,006 (GRCm39) missense probably damaging 1.00
R6349:Ank3 UTSW 10 69,815,269 (GRCm39) missense probably damaging 1.00
R6366:Ank3 UTSW 10 69,835,188 (GRCm39) missense probably damaging 1.00
R6371:Ank3 UTSW 10 69,644,709 (GRCm39) missense probably damaging 1.00
R6459:Ank3 UTSW 10 69,827,577 (GRCm39) intron probably benign
R6489:Ank3 UTSW 10 69,827,459 (GRCm39) missense probably benign 0.00
R6491:Ank3 UTSW 10 69,827,459 (GRCm39) missense probably benign 0.00
R6499:Ank3 UTSW 10 69,827,574 (GRCm39) intron probably benign
R6520:Ank3 UTSW 10 69,824,217 (GRCm39) missense probably damaging 1.00
R6521:Ank3 UTSW 10 69,828,596 (GRCm39) intron probably benign
R6535:Ank3 UTSW 10 69,713,684 (GRCm39) missense probably damaging 1.00
R6548:Ank3 UTSW 10 69,728,240 (GRCm39) missense probably damaging 1.00
R6587:Ank3 UTSW 10 69,825,982 (GRCm39) intron probably benign
R6624:Ank3 UTSW 10 69,740,298 (GRCm39) missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69,826,074 (GRCm39) intron probably benign
R6729:Ank3 UTSW 10 69,644,755 (GRCm39) missense probably damaging 1.00
R6731:Ank3 UTSW 10 69,849,858 (GRCm39) missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69,827,412 (GRCm39) intron probably benign
R6788:Ank3 UTSW 10 69,840,553 (GRCm39) missense probably damaging 1.00
R6846:Ank3 UTSW 10 69,660,179 (GRCm39) missense probably damaging 1.00
R6933:Ank3 UTSW 10 69,740,042 (GRCm39) missense probably damaging 1.00
R7034:Ank3 UTSW 10 69,835,209 (GRCm39) missense probably damaging 1.00
R7036:Ank3 UTSW 10 69,835,209 (GRCm39) missense probably damaging 1.00
R7132:Ank3 UTSW 10 69,825,744 (GRCm39) missense
R7171:Ank3 UTSW 10 69,828,311 (GRCm39) missense
R7241:Ank3 UTSW 10 69,542,644 (GRCm39) start codon destroyed probably null 0.11
R7386:Ank3 UTSW 10 69,658,079 (GRCm39) missense unknown
R7445:Ank3 UTSW 10 69,827,954 (GRCm39) missense
R7452:Ank3 UTSW 10 69,734,881 (GRCm39) missense possibly damaging 0.53
R7492:Ank3 UTSW 10 69,718,357 (GRCm39) missense unknown
R7494:Ank3 UTSW 10 69,824,756 (GRCm39) missense
R7512:Ank3 UTSW 10 69,826,691 (GRCm39) missense
R7543:Ank3 UTSW 10 69,786,846 (GRCm39) missense possibly damaging 0.96
R7577:Ank3 UTSW 10 69,828,402 (GRCm39) missense
R7610:Ank3 UTSW 10 69,822,252 (GRCm39) missense
R7673:Ank3 UTSW 10 69,826,331 (GRCm39) missense
R7682:Ank3 UTSW 10 69,824,065 (GRCm39) missense possibly damaging 0.53
R7814:Ank3 UTSW 10 69,822,734 (GRCm39) missense
R7835:Ank3 UTSW 10 69,823,557 (GRCm39) missense
R7843:Ank3 UTSW 10 69,822,788 (GRCm39) missense probably benign 0.01
R7891:Ank3 UTSW 10 69,824,139 (GRCm39) missense probably damaging 1.00
R8109:Ank3 UTSW 10 69,826,148 (GRCm39) missense
R8175:Ank3 UTSW 10 69,729,339 (GRCm39) missense unknown
R8210:Ank3 UTSW 10 69,811,925 (GRCm39) missense possibly damaging 0.72
R8211:Ank3 UTSW 10 69,703,228 (GRCm39) missense unknown
R8299:Ank3 UTSW 10 69,811,981 (GRCm39) missense probably damaging 0.98
R8302:Ank3 UTSW 10 69,840,810 (GRCm39) missense possibly damaging 0.73
R8516:Ank3 UTSW 10 69,763,559 (GRCm39) nonsense probably null
R8543:Ank3 UTSW 10 69,838,266 (GRCm39) missense probably damaging 1.00
R8549:Ank3 UTSW 10 69,818,012 (GRCm39) missense possibly damaging 0.74
R8726:Ank3 UTSW 10 69,823,084 (GRCm39) missense
R8729:Ank3 UTSW 10 69,838,428 (GRCm39) missense possibly damaging 0.85
R8735:Ank3 UTSW 10 69,822,785 (GRCm39) missense probably benign 0.24
R8751:Ank3 UTSW 10 69,761,849 (GRCm39) intron probably benign
R8788:Ank3 UTSW 10 69,718,256 (GRCm39) missense unknown
R8875:Ank3 UTSW 10 69,660,233 (GRCm39) missense unknown
R8919:Ank3 UTSW 10 69,840,671 (GRCm39) missense possibly damaging 0.72
R8932:Ank3 UTSW 10 69,660,292 (GRCm39) missense probably benign 0.00
R9053:Ank3 UTSW 10 69,822,389 (GRCm39) missense
R9064:Ank3 UTSW 10 69,822,185 (GRCm39) missense
R9084:Ank3 UTSW 10 69,786,879 (GRCm39) missense probably benign 0.12
R9160:Ank3 UTSW 10 69,838,304 (GRCm39) missense unknown
R9275:Ank3 UTSW 10 69,822,662 (GRCm39) missense probably damaging 1.00
R9280:Ank3 UTSW 10 69,818,021 (GRCm39) missense possibly damaging 0.83
R9300:Ank3 UTSW 10 69,706,872 (GRCm39) missense unknown
R9302:Ank3 UTSW 10 69,761,849 (GRCm39) intron probably benign
R9327:Ank3 UTSW 10 69,812,086 (GRCm39) critical splice donor site probably null
R9336:Ank3 UTSW 10 69,809,578 (GRCm39) missense probably benign 0.00
R9345:Ank3 UTSW 10 69,761,899 (GRCm39) intron probably benign
R9368:Ank3 UTSW 10 69,823,329 (GRCm39) missense
R9406:Ank3 UTSW 10 69,645,011 (GRCm39) missense unknown
R9491:Ank3 UTSW 10 69,838,339 (GRCm39) critical splice acceptor site probably null
R9573:Ank3 UTSW 10 69,791,977 (GRCm39) nonsense probably null
R9674:Ank3 UTSW 10 69,824,549 (GRCm39) missense
R9710:Ank3 UTSW 10 69,829,070 (GRCm39) missense
R9720:Ank3 UTSW 10 69,825,335 (GRCm39) missense
R9767:Ank3 UTSW 10 69,823,799 (GRCm39) missense probably damaging 1.00
R9800:Ank3 UTSW 10 69,733,957 (GRCm39) missense unknown
Z1176:Ank3 UTSW 10 69,827,045 (GRCm39) missense
Z1176:Ank3 UTSW 10 69,786,840 (GRCm39) missense possibly damaging 0.85
Z1176:Ank3 UTSW 10 69,768,304 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAAGACTAACTCTGAAAAGGGCAC -3'
(R):5'- CATTGATGATATGCGTGTGGCC -3'

Sequencing Primer
(F):5'- CCGTTTAGCAAAGCTGT -3'
(R):5'- TATGCGTGTGGCCCTGCTG -3'
Posted On 2014-09-17