Mutagenetix > Incidental Mutation

Incidental Mutation 'R2051:Nav3'

226446

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

040058-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2051 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109824675 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 678 (D678G)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032719
AA Change: D678G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: D678G

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161582

SMART Domains

Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

Domain	Start	End	E-Value	Type
low complexity region	84	95	N/A	INTRINSIC
low complexity region	150	173	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	354	372	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	551	562	N/A	INTRINSIC
low complexity region	570	589	N/A	INTRINSIC
low complexity region	604	618	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	739	751	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
coiled coil region	842	933	N/A	INTRINSIC
low complexity region	952	969	N/A	INTRINSIC
low complexity region	992	1003	N/A	INTRINSIC
low complexity region	1026	1051	N/A	INTRINSIC
low complexity region	1052	1065	N/A	INTRINSIC
coiled coil region	1071	1112	N/A	INTRINSIC
low complexity region	1118	1141	N/A	INTRINSIC
AAA	1299	1454	4.94e-7	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	G	A	5: 138,564,185	T98M	probably damaging	Het
4932414N04Rik	G	T	2: 68,711,048	K10N	possibly damaging	Het
Aadat	T	A	8: 60,507,139	S40T	probably benign	Het
Abca13	A	G	11: 9,328,098	I3093V	probably benign	Het
Acacb	A	T	5: 114,245,890	Q2160L	probably damaging	Het
Acp6	G	T	3: 97,168,017	S189I	probably benign	Het
Actr5	A	T	2: 158,632,293	M339L	probably benign	Het
Adcy1	A	T	11: 7,161,885	K917*	probably null	Het
Adgrg5	C	T	8: 94,942,067	R504C	probably benign	Het
Ago1	T	C	4: 126,460,453	H188R	probably benign	Het
Akap9	T	A	5: 3,975,685	C23*	probably null	Het
Ank3	T	C	10: 69,898,090	I728T	probably damaging	Het
Ankrd50	A	G	3: 38,454,493	S1242P	probably benign	Het
Arhgap29	G	A	3: 121,981,860	R84H	probably benign	Het
Arhgef10	A	G	8: 14,945,320	D7G	probably null	Het
Arid4b	A	G	13: 14,187,645	E898G	probably damaging	Het
Atrnl1	A	G	19: 57,691,849	N727S	probably benign	Het
Baalc	G	T	15: 38,933,234		probably benign	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Chpf2	G	T	5: 24,591,276	V407L	probably benign	Het
Chrnb3	C	A	8: 27,386,811	N84K	probably damaging	Het
Cnot1	A	G	8: 95,724,593	F2171L	possibly damaging	Het
Csmd3	C	T	15: 48,621,993		probably null	Het
Cux1	T	A	5: 136,332,658	Q138L	probably damaging	Het
Cyp2c65	A	G	19: 39,082,231	N286S	probably benign	Het
Dclre1b	T	C	3: 103,809,040	S17G	possibly damaging	Het
Dlgap5	A	G	14: 47,411,484	S221P	probably benign	Het
Dnah1	T	G	14: 31,279,123	T2422P	probably damaging	Het
Enpp1	A	G	10: 24,711,804		probably null	Het
Erbb2	T	C	11: 98,420,172	C53R	probably damaging	Het
Exoc8	A	G	8: 124,895,480	V716A	probably benign	Het
Fam193a	T	A	5: 34,462,150	D766E	probably benign	Het
Fbxo43	C	A	15: 36,162,132	G310W	probably damaging	Het
Fcgbp	C	T	7: 28,120,360	T2504I	probably damaging	Het
Fnbp4	C	T	2: 90,757,532	P418L	probably benign	Het
Gjd2	T	C	2: 114,011,058	T313A	probably damaging	Het
Gm12695	T	A	4: 96,769,771	R54W	probably damaging	Het
Gm128	T	C	3: 95,240,740	D81G	possibly damaging	Het
Gm21834	A	G	17: 57,741,768	V151A	possibly damaging	Het
Grhl1	T	A	12: 24,586,152		probably null	Het
Hcn1	C	T	13: 117,976,083	T861I	probably damaging	Het
Herc6	C	A	6: 57,625,976	Q547K	probably benign	Het
Iqgap3	T	C	3: 88,120,167	L699P	probably damaging	Het
Kank4	T	C	4: 98,780,102	D36G	probably damaging	Het
Kcnk5	A	T	14: 20,142,209	S295T	probably damaging	Het
Krt18	T	C	15: 102,029,500	V144A	probably benign	Het
Krtap9-5	A	G	11: 99,949,204	I244V	unknown	Het
Leng1	T	G	7: 3,665,401	N16T	probably damaging	Het
Lss	A	G	10: 76,531,878	K15E	possibly damaging	Het
Mastl	G	T	2: 23,132,824	A629E	possibly damaging	Het
Mavs	G	C	2: 131,240,450	A85P	possibly damaging	Het
Nsd3	T	G	8: 25,691,089	S906A	probably damaging	Het
Nsfl1c	A	G	2: 151,503,082	N118S	probably damaging	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1178	C	T	2: 88,391,538	T97M	possibly damaging	Het
Olfr429	T	A	1: 174,089,219	Y60N	possibly damaging	Het
Pax8	A	G	2: 24,436,508	S281P	probably benign	Het
Pds5b	T	G	5: 150,748,190	I433R	probably damaging	Het
Peg3	T	C	7: 6,712,721	N117D	probably damaging	Het
Pfkm	A	T	15: 98,131,692	D728V	probably benign	Het
Phkb	T	C	8: 86,049,821		probably null	Het
Pkp4	T	C	2: 59,334,904	V704A	probably benign	Het
Ppfia2	T	A	10: 106,837,299	S501T	probably damaging	Het
Ptpru	T	C	4: 131,819,087	E284G	possibly damaging	Het
Ror1	C	T	4: 100,407,868	R180*	probably null	Het
Ryr3	T	A	2: 112,756,641	Y2666F	probably damaging	Het
Sec23a	C	A	12: 58,990,968		probably null	Het
Sertad3	C	T	7: 27,476,269	Q43*	probably null	Het
Setd2	C	T	9: 110,550,890	H1258Y	probably benign	Het
Sharpin	A	G	15: 76,348,207	S177P	probably benign	Het
Skap1	T	C	11: 96,541,463	F86S	possibly damaging	Het
Slc8a2	T	C	7: 16,141,015	I396T	probably damaging	Het
Slc9a2	T	C	1: 40,726,437	F329S	probably damaging	Het
Slx4ip	C	T	2: 137,066,205	L161F	possibly damaging	Het
Sox4	A	G	13: 28,952,781	S81P	probably damaging	Het
Ssc4d	G	T	5: 135,970,264	S28R	probably benign	Het
St8sia2	C	T	7: 73,943,202	G369S	possibly damaging	Het
Swt1	T	C	1: 151,372,330	Y836C	probably damaging	Het
Taar7d	A	G	10: 24,028,006	D262G	probably benign	Het
Taar8b	T	A	10: 24,091,314	L327F	probably benign	Het
Tars	A	T	15: 11,393,194	L138*	probably null	Het
Tbcd	A	T	11: 121,453,670	D75V	probably damaging	Het
Tesc	A	G	5: 118,046,329	I25V	probably damaging	Het
Tmem132e	G	T	11: 82,440,438	S407I	probably damaging	Het
Tmem50b	C	A	16: 91,580,292	A95S	possibly damaging	Het
Tnr	T	C	1: 159,892,033	I960T	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn1	G	C	5: 120,543,388	P532A	probably damaging	Het
Tpsb2	T	C	17: 25,366,565		probably benign	Het
Triobp	C	A	15: 79,004,540	H1948Q	probably damaging	Het
Tshb	T	C	3: 102,777,541	I116V	probably benign	Het
Ttc13	A	T	8: 124,672,211		probably null	Het
Usp34	A	T	11: 23,464,468	T2804S	probably damaging	Het
Vmn2r18	A	T	5: 151,562,551	C493S	possibly damaging	Het
Vmn2r2	T	C	3: 64,117,345	K605R	possibly damaging	Het
Vmn2r37	T	C	7: 9,217,793	Y357C	probably damaging	Het
Zc3h6	T	G	2: 129,015,618	S686A	possibly damaging	Het
Zfp608	G	A	18: 54,988,314	P67L	probably benign	Het
Zyg11a	T	C	4: 108,192,047		probably benign	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7659:Nav3	UTSW	10	109766990	missense	probably benign	0.09
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
R7876:Nav3	UTSW	10	109853498	missense	probably benign	0.26
R8048:Nav3	UTSW	10	109764918	missense	probably benign	0.13
R8104:Nav3	UTSW	10	109758967	missense	probably damaging	0.99
R8125:Nav3	UTSW	10	109852659	missense	probably damaging	0.99
R8275:Nav3	UTSW	10	109692123	missense	noncoding transcript
R8325:Nav3	UTSW	10	109705603	missense	probably benign	0.24
R8336:Nav3	UTSW	10	109767569	missense	probably damaging	0.99
R8523:Nav3	UTSW	10	109823277	missense	probably damaging	1.00
R8529:Nav3	UTSW	10	109853331	missense	probably benign	0.09
R8745:Nav3	UTSW	10	109823450	missense	probably benign	0.08
R8752:Nav3	UTSW	10	109760304	intron	probably benign
R8794:Nav3	UTSW	10	109769171	nonsense	probably null
R8816:Nav3	UTSW	10	109863860	missense	possibly damaging	0.69
R9029:Nav3	UTSW	10	109863752	missense	possibly damaging	0.68
R9117:Nav3	UTSW	10	109684239	missense	probably benign	0.41
R9126:Nav3	UTSW	10	109705663	missense	probably benign
R9258:Nav3	UTSW	10	109714382	missense	probably damaging	0.99
R9347:Nav3	UTSW	10	109903094	missense	probably damaging	0.98
R9353:Nav3	UTSW	10	109718204	missense	probably damaging	0.99
R9366:Nav3	UTSW	10	109823503	missense	probably damaging	0.99
R9384:Nav3	UTSW	10	109718297	missense	probably damaging	0.98
R9428:Nav3	UTSW	10	109769315	missense	probably benign
R9454:Nav3	UTSW	10	110000003	missense	probably benign	0.01
R9516:Nav3	UTSW	10	109684154	missense	probably damaging	1.00
R9521:Nav3	UTSW	10	109999984	missense	possibly damaging	0.95
R9622:Nav3	UTSW	10	109767242	missense	probably benign
R9689:Nav3	UTSW	10	109769173	missense	probably damaging	1.00
R9796:Nav3	UTSW	10	109692108	missense	probably damaging	0.99
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATACAAGGATCTGACGTTCGC -3'
(R):5'- CTCTGATGAGAAATAGACTCACAAG -3'

Sequencing Primer
(F):5'- CAAGGATCTGACGTTCGCTTTGG -3'
(R):5'- ATGACAGGAGTCATCTGC -3'

Posted On

2014-09-17