Mutagenetix > Incidental Mutation

Incidental Mutation 'R2051:Usp34'

226449

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

040058-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R2051 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23464468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 2804 (T2804S)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129521

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: T2823S

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: T2823S

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148927

Predicted Effect

probably damaging
Transcript: ENSMUST00000180046
AA Change: T2804S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: T2804S

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	G	A	5: 138,564,185	T98M	probably damaging	Het
4932414N04Rik	G	T	2: 68,711,048	K10N	possibly damaging	Het
Aadat	T	A	8: 60,507,139	S40T	probably benign	Het
Abca13	A	G	11: 9,328,098	I3093V	probably benign	Het
Acacb	A	T	5: 114,245,890	Q2160L	probably damaging	Het
Acp6	G	T	3: 97,168,017	S189I	probably benign	Het
Actr5	A	T	2: 158,632,293	M339L	probably benign	Het
Adcy1	A	T	11: 7,161,885	K917*	probably null	Het
Adgrg5	C	T	8: 94,942,067	R504C	probably benign	Het
Ago1	T	C	4: 126,460,453	H188R	probably benign	Het
Akap9	T	A	5: 3,975,685	C23*	probably null	Het
Ank3	T	C	10: 69,898,090	I728T	probably damaging	Het
Ankrd50	A	G	3: 38,454,493	S1242P	probably benign	Het
Arhgap29	G	A	3: 121,981,860	R84H	probably benign	Het
Arhgef10	A	G	8: 14,945,320	D7G	probably null	Het
Arid4b	A	G	13: 14,187,645	E898G	probably damaging	Het
Atrnl1	A	G	19: 57,691,849	N727S	probably benign	Het
Baalc	G	T	15: 38,933,234		probably benign	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Chpf2	G	T	5: 24,591,276	V407L	probably benign	Het
Chrnb3	C	A	8: 27,386,811	N84K	probably damaging	Het
Cnot1	A	G	8: 95,724,593	F2171L	possibly damaging	Het
Csmd3	C	T	15: 48,621,993		probably null	Het
Cux1	T	A	5: 136,332,658	Q138L	probably damaging	Het
Cyp2c65	A	G	19: 39,082,231	N286S	probably benign	Het
Dclre1b	T	C	3: 103,809,040	S17G	possibly damaging	Het
Dlgap5	A	G	14: 47,411,484	S221P	probably benign	Het
Dnah1	T	G	14: 31,279,123	T2422P	probably damaging	Het
Enpp1	A	G	10: 24,711,804		probably null	Het
Erbb2	T	C	11: 98,420,172	C53R	probably damaging	Het
Exoc8	A	G	8: 124,895,480	V716A	probably benign	Het
Fam193a	T	A	5: 34,462,150	D766E	probably benign	Het
Fbxo43	C	A	15: 36,162,132	G310W	probably damaging	Het
Fcgbp	C	T	7: 28,120,360	T2504I	probably damaging	Het
Fnbp4	C	T	2: 90,757,532	P418L	probably benign	Het
Gjd2	T	C	2: 114,011,058	T313A	probably damaging	Het
Gm12695	T	A	4: 96,769,771	R54W	probably damaging	Het
Gm128	T	C	3: 95,240,740	D81G	possibly damaging	Het
Gm21834	A	G	17: 57,741,768	V151A	possibly damaging	Het
Grhl1	T	A	12: 24,586,152		probably null	Het
Hcn1	C	T	13: 117,976,083	T861I	probably damaging	Het
Herc6	C	A	6: 57,625,976	Q547K	probably benign	Het
Iqgap3	T	C	3: 88,120,167	L699P	probably damaging	Het
Kank4	T	C	4: 98,780,102	D36G	probably damaging	Het
Kcnk5	A	T	14: 20,142,209	S295T	probably damaging	Het
Krt18	T	C	15: 102,029,500	V144A	probably benign	Het
Krtap9-5	A	G	11: 99,949,204	I244V	unknown	Het
Leng1	T	G	7: 3,665,401	N16T	probably damaging	Het
Lss	A	G	10: 76,531,878	K15E	possibly damaging	Het
Mastl	G	T	2: 23,132,824	A629E	possibly damaging	Het
Mavs	G	C	2: 131,240,450	A85P	possibly damaging	Het
Nav3	T	C	10: 109,824,675	D678G	probably damaging	Het
Nsd3	T	G	8: 25,691,089	S906A	probably damaging	Het
Nsfl1c	A	G	2: 151,503,082	N118S	probably damaging	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1178	C	T	2: 88,391,538	T97M	possibly damaging	Het
Olfr429	T	A	1: 174,089,219	Y60N	possibly damaging	Het
Pax8	A	G	2: 24,436,508	S281P	probably benign	Het
Pds5b	T	G	5: 150,748,190	I433R	probably damaging	Het
Peg3	T	C	7: 6,712,721	N117D	probably damaging	Het
Pfkm	A	T	15: 98,131,692	D728V	probably benign	Het
Phkb	T	C	8: 86,049,821		probably null	Het
Pkp4	T	C	2: 59,334,904	V704A	probably benign	Het
Ppfia2	T	A	10: 106,837,299	S501T	probably damaging	Het
Ptpru	T	C	4: 131,819,087	E284G	possibly damaging	Het
Ror1	C	T	4: 100,407,868	R180*	probably null	Het
Ryr3	T	A	2: 112,756,641	Y2666F	probably damaging	Het
Sec23a	C	A	12: 58,990,968		probably null	Het
Sertad3	C	T	7: 27,476,269	Q43*	probably null	Het
Setd2	C	T	9: 110,550,890	H1258Y	probably benign	Het
Sharpin	A	G	15: 76,348,207	S177P	probably benign	Het
Skap1	T	C	11: 96,541,463	F86S	possibly damaging	Het
Slc8a2	T	C	7: 16,141,015	I396T	probably damaging	Het
Slc9a2	T	C	1: 40,726,437	F329S	probably damaging	Het
Slx4ip	C	T	2: 137,066,205	L161F	possibly damaging	Het
Sox4	A	G	13: 28,952,781	S81P	probably damaging	Het
Ssc4d	G	T	5: 135,970,264	S28R	probably benign	Het
St8sia2	C	T	7: 73,943,202	G369S	possibly damaging	Het
Swt1	T	C	1: 151,372,330	Y836C	probably damaging	Het
Taar7d	A	G	10: 24,028,006	D262G	probably benign	Het
Taar8b	T	A	10: 24,091,314	L327F	probably benign	Het
Tars	A	T	15: 11,393,194	L138*	probably null	Het
Tbcd	A	T	11: 121,453,670	D75V	probably damaging	Het
Tesc	A	G	5: 118,046,329	I25V	probably damaging	Het
Tmem132e	G	T	11: 82,440,438	S407I	probably damaging	Het
Tmem50b	C	A	16: 91,580,292	A95S	possibly damaging	Het
Tnr	T	C	1: 159,892,033	I960T	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpcn1	G	C	5: 120,543,388	P532A	probably damaging	Het
Tpsb2	T	C	17: 25,366,565		probably benign	Het
Triobp	C	A	15: 79,004,540	H1948Q	probably damaging	Het
Tshb	T	C	3: 102,777,541	I116V	probably benign	Het
Ttc13	A	T	8: 124,672,211		probably null	Het
Vmn2r18	A	T	5: 151,562,551	C493S	possibly damaging	Het
Vmn2r2	T	C	3: 64,117,345	K605R	possibly damaging	Het
Vmn2r37	T	C	7: 9,217,793	Y357C	probably damaging	Het
Zc3h6	T	G	2: 129,015,618	S686A	possibly damaging	Het
Zfp608	G	A	18: 54,988,314	P67L	probably benign	Het
Zyg11a	T	C	4: 108,192,047		probably benign	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATTCCGCCAGATGTTCCG -3'
(R):5'- AATGTTCTTGGTTACCACTGGG -3'

Sequencing Primer
(F):5'- ATGTTCCGGTCAACAAGGTC -3'
(R):5'- CCACTGGGTTCTGAACAATAAGGC -3'

Posted On

2014-09-17