Incidental Mutation 'R2051:Erbb2'
ID226453
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98420172 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 53 (C53R)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058295]
Predicted Effect probably damaging
Transcript: ENSMUST00000058295
AA Change: C53R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: C53R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158598
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1807:Erbb2 UTSW 11 98428854 missense probably damaging 1.00
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R3147:Erbb2 UTSW 11 98434039 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4240:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R5938:Erbb2 UTSW 11 98435571 missense probably damaging 0.99
R6062:Erbb2 UTSW 11 98433249 missense probably damaging 1.00
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6514:Erbb2 UTSW 11 98420146 missense probably benign 0.03
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
R7686:Erbb2 UTSW 11 98435573 missense probably benign
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTCTAGGCCCTGTGGATG -3'
(R):5'- AAAGGCACTCCTGATTGAGG -3'

Sequencing Primer
(F):5'- TCTGAGGTGACAGGACTCCAG -3'
(R):5'- CCTGATTGAGGAACCACAAGAG -3'
Posted On2014-09-17