Incidental Mutation 'R2051:Tbcd'
ID226456
Institutional Source Beutler Lab
Gene Symbol Tbcd
Ensembl Gene ENSMUSG00000039230
Gene Nametubulin-specific chaperone d
Synonyms2310057L06Rik, A030005L14Rik
MMRRC Submission 040058-MU
Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121451949-121617164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121453670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 75 (D75V)
Ref Sequence ENSEMBL: ENSMUSP00000099302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026175] [ENSMUST00000103013]
Predicted Effect probably benign
Transcript: ENSMUST00000026175
SMART Domains Protein: ENSMUSP00000026175
Gene: ENSMUSG00000025175

DomainStartEndE-ValueType
Pfam:Fructosamin_kin 1 309 2.3e-77 PFAM
Pfam:APH 20 277 4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103013
AA Change: D75V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230
AA Change: D75V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
SCOP:d1b3ua_ 357 742 4e-20 SMART
Pfam:TFCD_C 900 1090 1.4e-74 PFAM
low complexity region 1113 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Tbcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Tbcd APN 11 121575321 missense probably damaging 0.96
IGL00795:Tbcd APN 11 121616932 missense probably benign
IGL00802:Tbcd APN 11 121608610 missense possibly damaging 0.55
IGL01286:Tbcd APN 11 121493893 critical splice donor site probably null
IGL01325:Tbcd APN 11 121540993 missense probably damaging 0.99
IGL01348:Tbcd APN 11 121497076 missense probably benign
IGL01432:Tbcd APN 11 121475680 splice site probably benign
IGL01577:Tbcd APN 11 121497012 missense probably damaging 1.00
IGL01660:Tbcd APN 11 121605327 missense probably benign 0.01
IGL01865:Tbcd APN 11 121590380 missense possibly damaging 0.81
IGL02260:Tbcd APN 11 121603278 missense probably damaging 1.00
IGL02492:Tbcd APN 11 121497134 missense probably benign 0.06
IGL02620:Tbcd APN 11 121461255 missense probably damaging 1.00
IGL02950:Tbcd APN 11 121603709 missense probably damaging 0.99
R6859_Tbcd_818 UTSW 11 121497111 missense possibly damaging 0.81
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0077:Tbcd UTSW 11 121594274 missense probably benign 0.00
R0349:Tbcd UTSW 11 121602983 splice site probably null
R0865:Tbcd UTSW 11 121602989 missense possibly damaging 0.88
R1203:Tbcd UTSW 11 121475625 missense probably benign 0.00
R1221:Tbcd UTSW 11 121497083 missense probably benign 0.00
R1549:Tbcd UTSW 11 121560753 missense probably benign
R1586:Tbcd UTSW 11 121497060 missense probably benign 0.13
R1671:Tbcd UTSW 11 121597294 missense probably benign 0.00
R2048:Tbcd UTSW 11 121540936 missense probably damaging 1.00
R2124:Tbcd UTSW 11 121603320 missense probably damaging 1.00
R2151:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R2153:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R3120:Tbcd UTSW 11 121608648 missense probably damaging 0.97
R4108:Tbcd UTSW 11 121493811 missense probably benign 0.00
R4244:Tbcd UTSW 11 121594281 missense probably damaging 1.00
R4587:Tbcd UTSW 11 121605271 missense possibly damaging 0.75
R4684:Tbcd UTSW 11 121493771 missense probably damaging 1.00
R4837:Tbcd UTSW 11 121582785 critical splice donor site probably null
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4960:Tbcd UTSW 11 121573855 missense probably benign 0.03
R5157:Tbcd UTSW 11 121610027 missense probably benign 0.14
R5166:Tbcd UTSW 11 121609390 missense possibly damaging 0.87
R5403:Tbcd UTSW 11 121560743 missense probably damaging 0.99
R5406:Tbcd UTSW 11 121452101 missense probably benign
R5509:Tbcd UTSW 11 121602012 missense probably benign 0.00
R5767:Tbcd UTSW 11 121592692 missense probably benign 0.00
R5923:Tbcd UTSW 11 121580152 missense probably benign
R5966:Tbcd UTSW 11 121601911 intron probably benign
R6330:Tbcd UTSW 11 121497086 missense probably benign
R6539:Tbcd UTSW 11 121556987 critical splice donor site probably null
R6852:Tbcd UTSW 11 121609380 missense probably benign 0.36
R6859:Tbcd UTSW 11 121497111 missense possibly damaging 0.81
R7348:Tbcd UTSW 11 121594311 missense probably benign 0.22
R7479:Tbcd UTSW 11 121492605 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTGAGCATCTGTCAGCAAG -3'
(R):5'- CTGCACACAATCAAGATCGGTATC -3'

Sequencing Primer
(F):5'- AAGAAGCCAGGTGTGTCCCTG -3'
(R):5'- TAAGCCTTCCCGATCATC -3'
Posted On2014-09-17