Incidental Mutation 'R2051:Csmd3'
ID226468
Institutional Source Beutler Lab
Gene Symbol Csmd3
Ensembl Gene ENSMUSG00000022311
Gene NameCUB and Sushi multiple domains 3
Synonyms4930500N14Rik
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location47580637-48792063 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 48621993 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000160658] [ENSMUST00000162830] [ENSMUST00000162830]
Predicted Effect probably null
Transcript: ENSMUST00000100670
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100670
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160655
Predicted Effect probably null
Transcript: ENSMUST00000160658
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160658
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160716
Predicted Effect probably null
Transcript: ENSMUST00000162830
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162830
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Csmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Csmd3 APN 15 48287495 missense possibly damaging 0.61
IGL00591:Csmd3 APN 15 48004883 missense probably damaging 1.00
IGL00668:Csmd3 APN 15 47913945 missense probably damaging 1.00
IGL00753:Csmd3 APN 15 47644235 missense probably damaging 1.00
IGL00773:Csmd3 APN 15 47590719 missense probably damaging 0.96
IGL00926:Csmd3 APN 15 47710964 missense possibly damaging 0.87
IGL00942:Csmd3 APN 15 47847106 critical splice donor site probably null
IGL01080:Csmd3 APN 15 47881403 missense probably benign 0.12
IGL01314:Csmd3 APN 15 47849755 missense probably damaging 1.00
IGL01326:Csmd3 APN 15 47849785 missense probably benign 0.06
IGL01393:Csmd3 APN 15 48457599 missense possibly damaging 0.88
IGL01432:Csmd3 APN 15 47733499 missense probably damaging 1.00
IGL01519:Csmd3 APN 15 47596850 missense probably benign 0.31
IGL01530:Csmd3 APN 15 47838437 missense possibly damaging 0.95
IGL01530:Csmd3 APN 15 47669617 missense probably damaging 1.00
IGL01547:Csmd3 APN 15 47883617 missense probably benign 0.41
IGL01594:Csmd3 APN 15 47629239 missense probably benign 0.01
IGL01618:Csmd3 APN 15 48011083 missense probably benign 0.05
IGL01670:Csmd3 APN 15 47611829 missense probably damaging 1.00
IGL01680:Csmd3 APN 15 47970030 missense probably damaging 1.00
IGL01734:Csmd3 APN 15 48185304 missense probably damaging 1.00
IGL01777:Csmd3 APN 15 47698198 missense probably benign 0.06
IGL01779:Csmd3 APN 15 47857894 missense probably benign 0.10
IGL01820:Csmd3 APN 15 47607142 nonsense probably null
IGL01843:Csmd3 APN 15 47658999 splice site probably benign
IGL01919:Csmd3 APN 15 47675772 missense possibly damaging 0.62
IGL01986:Csmd3 APN 15 47659195 missense possibly damaging 0.82
IGL02049:Csmd3 APN 15 48001474 missense possibly damaging 0.91
IGL02065:Csmd3 APN 15 47666628 missense probably damaging 1.00
IGL02112:Csmd3 APN 15 48313869 missense possibly damaging 0.95
IGL02133:Csmd3 APN 15 47857942 missense possibly damaging 0.86
IGL02203:Csmd3 APN 15 47849677 splice site probably null
IGL02215:Csmd3 APN 15 47585688 missense probably damaging 1.00
IGL02234:Csmd3 APN 15 47948116 missense probably damaging 1.00
IGL02326:Csmd3 APN 15 47755963 splice site probably benign
IGL02478:Csmd3 APN 15 47838398 splice site probably benign
IGL02491:Csmd3 APN 15 47914115 splice site probably benign
IGL02598:Csmd3 APN 15 47669690 missense probably damaging 0.98
IGL02626:Csmd3 APN 15 47704107 splice site probably benign
IGL02696:Csmd3 APN 15 47669669 missense probably benign 0.33
IGL02876:Csmd3 APN 15 47606096 splice site probably benign
IGL02971:Csmd3 APN 15 47913929 splice site probably benign
IGL03068:Csmd3 APN 15 47847121 missense possibly damaging 0.69
IGL03087:Csmd3 APN 15 47977033 missense probably damaging 1.00
IGL03114:Csmd3 APN 15 47820451 missense probably damaging 0.99
IGL03146:Csmd3 APN 15 47881477 missense probably benign 0.25
IGL03193:Csmd3 APN 15 47629230 splice site probably benign
IGL03274:Csmd3 APN 15 47645504 missense probably damaging 1.00
R0040:Csmd3 UTSW 15 47633816 missense probably damaging 1.00
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0119:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0124:Csmd3 UTSW 15 47590716 missense probably damaging 1.00
R0127:Csmd3 UTSW 15 47981930 missense probably benign 0.45
R0136:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0201:Csmd3 UTSW 15 47619729 splice site probably benign
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0318:Csmd3 UTSW 15 47659153 missense probably damaging 1.00
R0369:Csmd3 UTSW 15 47970147 missense probably damaging 1.00
R0391:Csmd3 UTSW 15 47657573 missense probably damaging 1.00
R0499:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0506:Csmd3 UTSW 15 48457511 missense probably benign 0.00
R0606:Csmd3 UTSW 15 48457662 missense probably benign
R0639:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0658:Csmd3 UTSW 15 48011147 missense possibly damaging 0.66
R0673:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0689:Csmd3 UTSW 15 47756025 missense probably benign 0.19
R0696:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R0799:Csmd3 UTSW 15 48185384 splice site probably benign
R0834:Csmd3 UTSW 15 47883677 intron probably benign
R0894:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R0926:Csmd3 UTSW 15 47977033 missense probably damaging 1.00
R0943:Csmd3 UTSW 15 47675739 missense probably damaging 0.99
R0944:Csmd3 UTSW 15 47611831 missense probably damaging 1.00
R0967:Csmd3 UTSW 15 47857831 missense probably null 0.89
R0973:Csmd3 UTSW 15 47659089 missense probably damaging 1.00
R1055:Csmd3 UTSW 15 47881537 missense probably damaging 1.00
R1066:Csmd3 UTSW 15 47913965 missense probably damaging 1.00
R1086:Csmd3 UTSW 15 47695755 missense probably damaging 0.99
R1103:Csmd3 UTSW 15 47948006 missense probably damaging 1.00
R1136:Csmd3 UTSW 15 47675817 missense probably damaging 1.00
R1139:Csmd3 UTSW 15 47695836 missense probably damaging 1.00
R1158:Csmd3 UTSW 15 48292774 splice site probably null
R1215:Csmd3 UTSW 15 48004831 unclassified probably null
R1233:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R1271:Csmd3 UTSW 15 48011059 missense probably benign 0.11
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1479:Csmd3 UTSW 15 47857886 missense probably damaging 1.00
R1480:Csmd3 UTSW 15 47731929 missense possibly damaging 0.90
R1526:Csmd3 UTSW 15 47585632 critical splice donor site probably null
R1527:Csmd3 UTSW 15 47948087 missense probably benign 0.08
R1539:Csmd3 UTSW 15 47820398 missense probably benign 0.24
R1544:Csmd3 UTSW 15 47611898 splice site probably null
R1548:Csmd3 UTSW 15 47981975 missense possibly damaging 0.91
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1619:Csmd3 UTSW 15 47949950 missense probably damaging 1.00
R1630:Csmd3 UTSW 15 47838522 missense possibly damaging 0.66
R1665:Csmd3 UTSW 15 47696789 missense probably damaging 1.00
R1680:Csmd3 UTSW 15 47741170 missense probably damaging 1.00
R1725:Csmd3 UTSW 15 47596807 missense probably damaging 1.00
R1743:Csmd3 UTSW 15 48622089 missense probably damaging 1.00
R1749:Csmd3 UTSW 15 47585660 missense probably damaging 1.00
R1752:Csmd3 UTSW 15 47660273 missense probably benign 0.15
R1769:Csmd3 UTSW 15 47704109 splice site probably benign
R1775:Csmd3 UTSW 15 47899739 missense probably damaging 0.99
R1795:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R1819:Csmd3 UTSW 15 47753735 missense possibly damaging 0.56
R1840:Csmd3 UTSW 15 47607164 missense probably damaging 1.00
R1860:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1861:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1879:Csmd3 UTSW 15 47657519 missense possibly damaging 0.90
R1958:Csmd3 UTSW 15 48004639 critical splice donor site probably null
R1965:Csmd3 UTSW 15 47849748 missense probably benign 0.15
R1970:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R2029:Csmd3 UTSW 15 47838579 missense probably damaging 1.00
R2108:Csmd3 UTSW 15 48004861 missense possibly damaging 0.81
R2132:Csmd3 UTSW 15 48457503 missense probably benign 0.06
R2146:Csmd3 UTSW 15 47741236 frame shift probably null
R2147:Csmd3 UTSW 15 47741236 frame shift probably null
R2148:Csmd3 UTSW 15 47741236 frame shift probably null
R2157:Csmd3 UTSW 15 47695787 missense probably damaging 0.99
R2159:Csmd3 UTSW 15 47741236 frame shift probably null
R2160:Csmd3 UTSW 15 47741236 frame shift probably null
R2161:Csmd3 UTSW 15 47741236 frame shift probably null
R2162:Csmd3 UTSW 15 47741236 frame shift probably null
R2164:Csmd3 UTSW 15 47741236 frame shift probably null
R2213:Csmd3 UTSW 15 47820447 missense possibly damaging 0.92
R2301:Csmd3 UTSW 15 47731998 missense probably damaging 1.00
R2302:Csmd3 UTSW 15 48314051 missense probably benign
R2355:Csmd3 UTSW 15 47741236 frame shift probably null
R2497:Csmd3 UTSW 15 47741236 frame shift probably null
R2509:Csmd3 UTSW 15 47741236 frame shift probably null
R2566:Csmd3 UTSW 15 47741236 frame shift probably null
R2567:Csmd3 UTSW 15 47741236 frame shift probably null
R2568:Csmd3 UTSW 15 47741236 frame shift probably null
R2570:Csmd3 UTSW 15 47741236 frame shift probably null
R2571:Csmd3 UTSW 15 47741236 frame shift probably null
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2907:Csmd3 UTSW 15 48011053 missense probably damaging 0.99
R3116:Csmd3 UTSW 15 47657599 missense probably damaging 1.00
R3423:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3425:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3508:Csmd3 UTSW 15 47741236 frame shift probably null
R3746:Csmd3 UTSW 15 47849766 missense probably benign 0.04
R3813:Csmd3 UTSW 15 48791813 missense possibly damaging 0.82
R3832:Csmd3 UTSW 15 47741236 frame shift probably null
R3959:Csmd3 UTSW 15 47644189 missense probably benign 0.18
R4042:Csmd3 UTSW 15 47614084 missense probably damaging 1.00
R4043:Csmd3 UTSW 15 47755966 critical splice donor site probably null
R4191:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4192:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4419:Csmd3 UTSW 15 47704311 missense probably damaging 1.00
R4426:Csmd3 UTSW 15 47669185 missense possibly damaging 0.51
R4434:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4438:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4490:Csmd3 UTSW 15 48314033 missense possibly damaging 0.83
R4562:Csmd3 UTSW 15 47899844 missense probably benign 0.32
R4604:Csmd3 UTSW 15 48004815 missense possibly damaging 0.90
R4620:Csmd3 UTSW 15 47585753 missense probably benign 0.09
R4632:Csmd3 UTSW 15 48011209 missense probably damaging 0.99
R4679:Csmd3 UTSW 15 48161083 nonsense probably null
R4696:Csmd3 UTSW 15 47913968 missense probably benign 0.24
R4718:Csmd3 UTSW 15 47698150 nonsense probably null
R4723:Csmd3 UTSW 15 47669160 missense probably benign 0.29
R4801:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4802:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4806:Csmd3 UTSW 15 48314068 missense probably benign
R4816:Csmd3 UTSW 15 47857934 missense possibly damaging 0.68
R4935:Csmd3 UTSW 15 48161084 missense probably damaging 1.00
R4955:Csmd3 UTSW 15 48673518 missense probably damaging 0.99
R4991:Csmd3 UTSW 15 48001478 missense probably damaging 1.00
R5031:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R5034:Csmd3 UTSW 15 47629287 missense possibly damaging 0.94
R5035:Csmd3 UTSW 15 47590779 missense probably damaging 1.00
R5120:Csmd3 UTSW 15 48673495 nonsense probably null
R5224:Csmd3 UTSW 15 47888684 missense possibly damaging 0.91
R5235:Csmd3 UTSW 15 47629278 missense probably benign 0.20
R5279:Csmd3 UTSW 15 48791944 unclassified probably null
R5360:Csmd3 UTSW 15 47669203 missense probably damaging 0.99
R5365:Csmd3 UTSW 15 48004749 missense possibly damaging 0.68
R5379:Csmd3 UTSW 15 47636450 nonsense probably null
R5381:Csmd3 UTSW 15 47741215 missense probably benign 0.21
R5393:Csmd3 UTSW 15 47633703 missense probably damaging 1.00
R5413:Csmd3 UTSW 15 47838435 missense probably damaging 1.00
R5549:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5550:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5551:Csmd3 UTSW 15 48314096 missense probably benign 0.13
R5567:Csmd3 UTSW 15 47645468 missense possibly damaging 0.92
R5621:Csmd3 UTSW 15 48313978 missense possibly damaging 0.84
R5668:Csmd3 UTSW 15 47695755 missense possibly damaging 0.48
R5677:Csmd3 UTSW 15 48622051 missense probably damaging 0.98
R5701:Csmd3 UTSW 15 47650221 missense probably damaging 1.00
R5701:Csmd3 UTSW 15 48540333 missense probably damaging 0.99
R5871:Csmd3 UTSW 15 47888716 missense probably damaging 0.98
R5872:Csmd3 UTSW 15 47582527 missense probably damaging 1.00
R5874:Csmd3 UTSW 15 47644270 missense probably damaging 1.00
R5952:Csmd3 UTSW 15 47733505 missense probably damaging 0.98
R5956:Csmd3 UTSW 15 48791882 missense possibly damaging 0.84
R5966:Csmd3 UTSW 15 47849739 missense probably damaging 0.96
R5969:Csmd3 UTSW 15 47947990 missense probably damaging 1.00
R5989:Csmd3 UTSW 15 47590764 missense possibly damaging 0.69
R6017:Csmd3 UTSW 15 48314012 missense possibly damaging 0.95
R6057:Csmd3 UTSW 15 47755391 missense probably damaging 1.00
R6127:Csmd3 UTSW 15 47650228 missense probably damaging 1.00
R6178:Csmd3 UTSW 15 48673458 missense probably damaging 1.00
R6198:Csmd3 UTSW 15 48313877 missense probably benign 0.28
R6213:Csmd3 UTSW 15 47629260 missense probably damaging 1.00
R6256:Csmd3 UTSW 15 47669729 missense probably damaging 1.00
R6274:Csmd3 UTSW 15 47621437 missense probably benign
R6327:Csmd3 UTSW 15 47881387 missense probably damaging 1.00
R6354:Csmd3 UTSW 15 47881489 missense probably damaging 1.00
R6405:Csmd3 UTSW 15 47820371 missense probably damaging 0.99
R6410:Csmd3 UTSW 15 48673407 missense probably damaging 1.00
R6416:Csmd3 UTSW 15 48673560 missense probably damaging 1.00
R6463:Csmd3 UTSW 15 47676479 missense probably damaging 1.00
R6536:Csmd3 UTSW 15 47838467 missense probably damaging 1.00
R6625:Csmd3 UTSW 15 47607075 missense probably benign 0.02
R6695:Csmd3 UTSW 15 47857834 missense probably damaging 0.99
R6895:Csmd3 UTSW 15 47666514 splice site probably null
R6906:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R6914:Csmd3 UTSW 15 48011138 missense possibly damaging 0.53
R6920:Csmd3 UTSW 15 47644205 missense probably damaging 1.00
R7024:Csmd3 UTSW 15 47710991 missense probably damaging 1.00
R7178:Csmd3 UTSW 15 47590774 missense
R7192:Csmd3 UTSW 15 47704237 missense
R7220:Csmd3 UTSW 15 48457598 missense probably damaging 0.99
R7362:Csmd3 UTSW 15 47755992 missense possibly damaging 0.65
R7380:Csmd3 UTSW 15 47586965 missense
R7397:Csmd3 UTSW 15 47695734 missense
R7467:Csmd3 UTSW 15 47629244 missense
R7585:Csmd3 UTSW 15 48622075 missense possibly damaging 0.76
R7623:Csmd3 UTSW 15 47949938 missense
R7649:Csmd3 UTSW 15 47669143 missense
R7691:Csmd3 UTSW 15 47741173 missense
R7695:Csmd3 UTSW 15 47820381 missense
U24488:Csmd3 UTSW 15 47710399 missense probably damaging 1.00
V8831:Csmd3 UTSW 15 48457696 missense probably damaging 0.96
X0021:Csmd3 UTSW 15 47970093 nonsense probably null
Z1088:Csmd3 UTSW 15 47636393 missense probably damaging 1.00
Z1088:Csmd3 UTSW 15 47847281 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATGCATATCCATGGTGC -3'
(R):5'- TTGAAGGACATTGATCTACACACC -3'

Sequencing Primer
(F):5'- tGAAGCCATCTCTTCACA -3'
(R):5'- AGGGAATTTGATAACATGCCTTC -3'
Posted On2014-09-17