Incidental Mutation 'R2051:Triobp'
ID226470
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79004540 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1948 (H1948Q)
Ref Sequence ENSEMBL: ENSMUSP00000105311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109687
AA Change: H607Q

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: H607Q

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: H1948Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: H1948Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: H1994Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: H1994Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAATGAAATCTCCATCACTGGG -3'
(R):5'- CAGACTTGGACTGTCCTATGG -3'

Sequencing Primer
(F):5'- GCTACCAGCAGGGGCAAAG -3'
(R):5'- GGACTGTCCTATGGCCATAAC -3'
Posted On2014-09-17