Incidental Mutation 'R2054:Aim2'
ID226487
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Nameabsent in melanoma 2
SynonymsLOC383619, Ifi210
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173350879-173466040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173463982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 318 (F318L)
Ref Sequence ENSEMBL: ENSMUSP00000132253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000160565] [ENSMUST00000166137] [ENSMUST00000173023]
Predicted Effect probably damaging
Transcript: ENSMUST00000147604
AA Change: F318L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: F318L

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160565
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000166137
AA Change: F318L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: F318L

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192575
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173455465 missense probably benign 0.23
IGL01086:Aim2 APN 1 173455433 missense probably damaging 0.99
IGL02292:Aim2 APN 1 173462274 missense probably benign 0.05
IGL02382:Aim2 APN 1 173459749 splice site probably null
R0226:Aim2 UTSW 1 173462333 unclassified probably benign
R0609:Aim2 UTSW 1 173461964 missense probably damaging 0.98
R1281:Aim2 UTSW 1 173459811 nonsense probably null
R2110:Aim2 UTSW 1 173459713 missense probably benign 0.00
R4080:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4081:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4082:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4452:Aim2 UTSW 1 173455444 missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173455524 synonymous silent
R4731:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173459806 missense probably benign 0.04
R5009:Aim2 UTSW 1 173455366 missense probably damaging 0.96
R6290:Aim2 UTSW 1 173462115 missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173455236 splice site probably null
R6821:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6836:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6838:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6994:Aim2 UTSW 1 173455586 missense possibly damaging 0.80
R7893:Aim2 UTSW 1 173463926 missense possibly damaging 0.95
R8175:Aim2 UTSW 1 173455354 start codon destroyed possibly damaging 0.75
R8459:Aim2 UTSW 1 173461970 unclassified probably benign
R8680:Aim2 UTSW 1 173462220 missense probably damaging 1.00
X0021:Aim2 UTSW 1 173463919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTGCTCCTAGCTTGTCTG -3'
(R):5'- ACAGGCTTCTCAGGTCTGTGAG -3'

Sequencing Primer
(F):5'- AAGCTGCTCCTAGCTTGTCTGATAAC -3'
(R):5'- TCTCAGGTCTGTGAGATGCAAAG -3'
Posted On2014-09-17