Incidental Mutation 'R2054:Zfp64'
ID226496
Institutional Source Beutler Lab
Gene Symbol Zfp64
Ensembl Gene ENSMUSG00000027551
Gene Namezinc finger protein 64
Synonyms
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168893331-168955587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168925808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 628 (V628A)
Ref Sequence ENSEMBL: ENSMUSP00000085285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087971] [ENSMUST00000109162]
Predicted Effect probably damaging
Transcript: ENSMUST00000087971
AA Change: V628A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085285
Gene: ENSMUSG00000027551
AA Change: V628A

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 308 6.32e-3 SMART
ZnF_C2H2 313 335 2.05e-2 SMART
ZnF_C2H2 341 363 1.95e-3 SMART
ZnF_C2H2 369 392 1.36e-2 SMART
ZnF_C2H2 423 445 1.47e-3 SMART
low complexity region 503 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109162
SMART Domains Protein: ENSMUSP00000104790
Gene: ENSMUSG00000027551

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 297 322 5.2e0 SMART
ZnF_C2H2 328 350 4.17e-3 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.24e-3 SMART
ZnF_C2H2 412 434 1.79e-2 SMART
ZnF_C2H2 440 463 9.58e-3 SMART
ZnF_C2H2 465 487 3.78e-1 SMART
ZnF_C2H2 493 515 3.89e-3 SMART
ZnF_C2H2 521 544 1.92e-2 SMART
ZnF_C2H2 578 600 5.34e-1 SMART
Meta Mutation Damage Score 0.4963 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Other mutations in Zfp64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Zfp64 APN 2 168926681 missense probably benign 0.06
IGL01479:Zfp64 APN 2 168951679 missense probably damaging 1.00
IGL02320:Zfp64 APN 2 168926198 missense probably damaging 0.98
IGL03411:Zfp64 APN 2 168951542 splice site probably null
PIT4362001:Zfp64 UTSW 2 168925815 missense probably benign 0.23
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0230:Zfp64 UTSW 2 168912230 splice site probably benign
R0325:Zfp64 UTSW 2 168926040 missense probably benign 0.00
R0689:Zfp64 UTSW 2 168935201 splice site probably benign
R1741:Zfp64 UTSW 2 168926318 missense probably benign 0.05
R2133:Zfp64 UTSW 2 168940743 missense probably damaging 1.00
R2254:Zfp64 UTSW 2 168926742 missense probably damaging 0.96
R4093:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4094:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4257:Zfp64 UTSW 2 168926378 missense probably damaging 1.00
R4630:Zfp64 UTSW 2 168926543 missense possibly damaging 0.94
R4642:Zfp64 UTSW 2 168934931 missense probably benign 0.22
R4817:Zfp64 UTSW 2 168926112 missense probably benign
R4880:Zfp64 UTSW 2 168894377 missense probably damaging 1.00
R5051:Zfp64 UTSW 2 168926384 missense probably damaging 0.98
R5155:Zfp64 UTSW 2 168906965 missense probably benign 0.17
R5562:Zfp64 UTSW 2 168925722 missense probably benign 0.00
R5619:Zfp64 UTSW 2 168899814 missense probably damaging 0.99
R5619:Zfp64 UTSW 2 168899815 missense probably damaging 0.97
R5620:Zfp64 UTSW 2 168899968 missense possibly damaging 0.70
R5919:Zfp64 UTSW 2 168926499 missense probably benign 0.05
R6156:Zfp64 UTSW 2 168926168 missense probably benign 0.34
R6364:Zfp64 UTSW 2 168912266 missense probably damaging 1.00
R6488:Zfp64 UTSW 2 168935209 critical splice donor site probably null
R6512:Zfp64 UTSW 2 168894077 missense probably benign 0.00
R6588:Zfp64 UTSW 2 168926907 missense probably damaging 1.00
R7103:Zfp64 UTSW 2 168926437 missense probably benign 0.00
R7313:Zfp64 UTSW 2 168899890 missense probably damaging 1.00
R7470:Zfp64 UTSW 2 168925811 missense probably damaging 1.00
R7529:Zfp64 UTSW 2 168894072 missense probably benign
R7560:Zfp64 UTSW 2 168925665 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTACTCCTCTCGCAG -3'
(R):5'- TGAGTCAGCCAACTGTCCTG -3'

Sequencing Primer
(F):5'- GCAGTTTGTCTTGTCTGTCAC -3'
(R):5'- AGCCAACTGTCCTGCTGAC -3'
Posted On2014-09-17