Incidental Mutation 'R2054:Npr2'
ID226504
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Namenatriuretic peptide receptor 2
Synonymspwe, cn, guanylyl cyclase-B
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43631935-43651244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43646560 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 636 (N636I)
Ref Sequence ENSEMBL: ENSMUSP00000030191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000084646] [ENSMUST00000107874]
Predicted Effect probably damaging
Transcript: ENSMUST00000030191
AA Change: N636I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: N636I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084646
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107874
AA Change: N636I

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: N636I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123351
SMART Domains Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 71 173 1.3e-12 PFAM
Pfam:Pkinase 85 170 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect unknown
Transcript: ENSMUST00000128549
AA Change: N201I
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469
AA Change: N201I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Meta Mutation Damage Score 0.7114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 unclassified probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGGAAGTGATGGCTTTC -3'
(R):5'- ACCAAGGCTTGAAGGGTGAC -3'

Sequencing Primer
(F):5'- TCCAGTCGAGGCTCTACAG -3'
(R):5'- CTTGAAGGGTGACATAAAAGGTAGGC -3'
Posted On2014-09-17