Incidental Mutation 'R2054:Smc2'
ID226505
Institutional Source Beutler Lab
Gene Symbol Smc2
Ensembl Gene ENSMUSG00000028312
Gene Namestructural maintenance of chromosomes 2
SynonymsCAP-E, Fin16, 5730502P04Rik, Smc2l1
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location52439243-52488260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52462948 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 646 (M646K)
Ref Sequence ENSEMBL: ENSMUSP00000113940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280] [ENSMUST00000142227]
Predicted Effect probably benign
Transcript: ENSMUST00000102915
AA Change: M646K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312
AA Change: M646K

DomainStartEndE-ValueType
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117280
AA Change: M646K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312
AA Change: M646K

DomainStartEndE-ValueType
Pfam:AAA_21 27 131 3.8e-6 PFAM
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142227
SMART Domains Protein: ENSMUSP00000114228
Gene: ENSMUSG00000028312

DomainStartEndE-ValueType
Pfam:SMC_N 2 351 2.3e-36 PFAM
Pfam:AAA_21 27 131 1.7e-8 PFAM
coiled coil region 400 471 N/A INTRINSIC
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Smc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Smc2 APN 4 52450842 missense probably damaging 1.00
IGL02045:Smc2 APN 4 52462914 missense probably benign 0.01
IGL03013:Smc2 APN 4 52442280 missense probably damaging 1.00
IGL03031:Smc2 APN 4 52449638 missense probably benign 0.35
IGL03246:Smc2 APN 4 52440301 nonsense probably null
Janitor UTSW 4 52478448 missense probably damaging 1.00
R0539:Smc2 UTSW 4 52458558 missense probably benign 0.01
R0782:Smc2 UTSW 4 52469799 missense probably benign 0.30
R1908:Smc2 UTSW 4 52450863 missense probably damaging 0.97
R2109:Smc2 UTSW 4 52474987 missense probably benign 0.00
R2318:Smc2 UTSW 4 52446030 missense probably damaging 1.00
R2352:Smc2 UTSW 4 52460266 missense probably benign
R3418:Smc2 UTSW 4 52476850 splice site probably benign
R4003:Smc2 UTSW 4 52462897 missense probably damaging 1.00
R4133:Smc2 UTSW 4 52450947 missense probably damaging 0.99
R4299:Smc2 UTSW 4 52440238 utr 5 prime probably benign
R4547:Smc2 UTSW 4 52467866 missense probably benign 0.09
R4787:Smc2 UTSW 4 52462927 missense probably damaging 0.98
R4816:Smc2 UTSW 4 52451231 missense probably benign 0.00
R4829:Smc2 UTSW 4 52449612 missense probably damaging 0.98
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4951:Smc2 UTSW 4 52462926 missense possibly damaging 0.95
R4963:Smc2 UTSW 4 52450826 missense probably damaging 1.00
R4996:Smc2 UTSW 4 52461042 splice site probably null
R5028:Smc2 UTSW 4 52458447 missense probably damaging 0.96
R5103:Smc2 UTSW 4 52459033 missense probably damaging 1.00
R5159:Smc2 UTSW 4 52460181 missense possibly damaging 0.65
R5387:Smc2 UTSW 4 52475096 missense probably benign 0.16
R5697:Smc2 UTSW 4 52459045 missense probably benign 0.01
R6006:Smc2 UTSW 4 52459024 missense probably benign
R6246:Smc2 UTSW 4 52460289 missense probably damaging 1.00
R6321:Smc2 UTSW 4 52462814 missense probably benign
R6590:Smc2 UTSW 4 52449375 missense probably benign 0.01
R6658:Smc2 UTSW 4 52451322 missense probably benign 0.21
R6690:Smc2 UTSW 4 52449375 missense probably benign 0.01
R7422:Smc2 UTSW 4 52440301 missense probably benign 0.02
R7486:Smc2 UTSW 4 52462861 missense possibly damaging 0.54
R7487:Smc2 UTSW 4 52478448 missense probably damaging 1.00
R7532:Smc2 UTSW 4 52451013 missense probably damaging 1.00
R7556:Smc2 UTSW 4 52457379 missense probably benign 0.03
R7912:Smc2 UTSW 4 52450854 missense probably benign 0.00
R7953:Smc2 UTSW 4 52470911 critical splice donor site probably null
R7979:Smc2 UTSW 4 52450857 missense probably damaging 1.00
R8343:Smc2 UTSW 4 52450965 missense probably benign
R8344:Smc2 UTSW 4 52449376 missense probably benign 0.01
R8495:Smc2 UTSW 4 52450992 missense probably benign 0.00
RF006:Smc2 UTSW 4 52442276 missense probably benign 0.03
X0065:Smc2 UTSW 4 52440370 missense probably damaging 1.00
Z1176:Smc2 UTSW 4 52481682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTAGTGTGTCCTGTGATAGATC -3'
(R):5'- CTGAGTTGATCCATGATAGTGAATC -3'

Sequencing Primer
(F):5'- TGTAGGTTGGTCCTGACA -3'
(R):5'- ATAAGCCACTTGAGCGCTTTGAC -3'
Posted On2014-09-17