Incidental Mutation 'R2054:9330182L06Rik'
ID226511
Institutional Source Beutler Lab
Gene Symbol 9330182L06Rik
Ensembl Gene ENSMUSG00000056004
Gene NameRIKEN cDNA 9330182L06 gene
Synonyms
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location9266118-9481825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9463030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1008 (T1008K)
Ref Sequence ENSEMBL: ENSMUSP00000121757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069538] [ENSMUST00000115348] [ENSMUST00000134991] [ENSMUST00000152095] [ENSMUST00000154662] [ENSMUST00000155764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069538
AA Change: T1008K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069165
Gene: ENSMUSG00000056004
AA Change: T1008K

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 1.12e-7 PROSPERO
internal_repeat_1 343 665 1.12e-7 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115348
SMART Domains Protein: ENSMUSP00000111005
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134991
AA Change: T1008K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121757
Gene: ENSMUSG00000056004
AA Change: T1008K

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 9.82e-8 PROSPERO
internal_repeat_1 343 665 9.82e-8 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152095
SMART Domains Protein: ENSMUSP00000116440
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154662
SMART Domains Protein: ENSMUSP00000116026
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155764
SMART Domains Protein: ENSMUSP00000120849
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 180 5.47e-6 PROSPERO
internal_repeat_1 343 476 5.47e-6 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in 9330182L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:9330182L06Rik APN 5 9422367 missense probably damaging 0.99
IGL00909:9330182L06Rik APN 5 9380282 missense probably damaging 1.00
IGL01477:9330182L06Rik APN 5 9437756 missense probably damaging 1.00
IGL02486:9330182L06Rik APN 5 9422323 missense probably benign 0.00
IGL02863:9330182L06Rik APN 5 9461399 nonsense probably null
IGL02939:9330182L06Rik APN 5 9461478 missense probably damaging 1.00
IGL03039:9330182L06Rik APN 5 9418055 missense probably benign 0.12
IGL03395:9330182L06Rik APN 5 9422359 missense probably damaging 0.97
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0193:9330182L06Rik UTSW 5 9422359 missense probably damaging 0.97
R0265:9330182L06Rik UTSW 5 9434681 missense probably damaging 1.00
R0398:9330182L06Rik UTSW 5 9445367 missense probably benign 0.00
R0432:9330182L06Rik UTSW 5 9440966 nonsense probably null
R0494:9330182L06Rik UTSW 5 9420723 critical splice donor site probably null
R0736:9330182L06Rik UTSW 5 9441745 missense probably damaging 1.00
R0850:9330182L06Rik UTSW 5 9417993 missense probably damaging 1.00
R1398:9330182L06Rik UTSW 5 9380297 missense probably damaging 1.00
R1709:9330182L06Rik UTSW 5 9440726 nonsense probably null
R1720:9330182L06Rik UTSW 5 9428407 missense probably damaging 1.00
R1770:9330182L06Rik UTSW 5 9418021 missense probably benign 0.01
R1782:9330182L06Rik UTSW 5 9421620 missense possibly damaging 0.62
R1803:9330182L06Rik UTSW 5 9427832 missense probably benign 0.05
R1868:9330182L06Rik UTSW 5 9479251 missense probably damaging 1.00
R1870:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1871:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1913:9330182L06Rik UTSW 5 9266275 missense probably damaging 0.97
R2170:9330182L06Rik UTSW 5 9479206 missense probably damaging 1.00
R2381:9330182L06Rik UTSW 5 9380342 missense probably damaging 1.00
R2396:9330182L06Rik UTSW 5 9435395 missense possibly damaging 0.92
R4003:9330182L06Rik UTSW 5 9440877 missense probably benign 0.05
R5030:9330182L06Rik UTSW 5 9428502 missense probably damaging 1.00
R5049:9330182L06Rik UTSW 5 9428488 missense probably damaging 1.00
R5069:9330182L06Rik UTSW 5 9440897 missense probably damaging 1.00
R5219:9330182L06Rik UTSW 5 9461486 missense probably damaging 1.00
R5400:9330182L06Rik UTSW 5 9479247 missense probably damaging 1.00
R5555:9330182L06Rik UTSW 5 9422296 splice site probably null
R5593:9330182L06Rik UTSW 5 9266350 missense probably benign 0.07
R5681:9330182L06Rik UTSW 5 9459308 critical splice donor site probably null
R5707:9330182L06Rik UTSW 5 9441698 missense probably damaging 1.00
R5756:9330182L06Rik UTSW 5 9462995 missense probably damaging 0.98
R6087:9330182L06Rik UTSW 5 9399255 missense probably damaging 1.00
R6252:9330182L06Rik UTSW 5 9410693 missense probably damaging 1.00
R7067:9330182L06Rik UTSW 5 9266295 missense possibly damaging 0.81
R7078:9330182L06Rik UTSW 5 9410709 missense probably benign 0.10
R7079:9330182L06Rik UTSW 5 9399253 missense probably damaging 1.00
R7117:9330182L06Rik UTSW 5 9445384 nonsense probably null
R7265:9330182L06Rik UTSW 5 9446975 missense possibly damaging 0.65
R7996:9330182L06Rik UTSW 5 9462881 missense probably damaging 1.00
R8199:9330182L06Rik UTSW 5 9420657 missense probably damaging 1.00
R8246:9330182L06Rik UTSW 5 9446966 missense probably benign 0.07
X0019:9330182L06Rik UTSW 5 9399231 missense probably damaging 0.97
X0052:9330182L06Rik UTSW 5 9440908 missense possibly damaging 0.87
X0063:9330182L06Rik UTSW 5 9399239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTACCCCTGCTTAGGCTG -3'
(R):5'- AGGTTTCTTCACGAACTCTTGTAG -3'

Sequencing Primer
(F):5'- CTGCTTAGGCTGGAATACAAATATTC -3'
(R):5'- GAGGCTGAACAGGTCATTTCTAC -3'
Posted On2014-09-17