Incidental Mutation 'R2054:Leng8'
ID226518
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Nameleukocyte receptor cluster (LRC) member 8
Synonyms
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4137039-4148177 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 4144290 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 562 (Y562*)
Ref Sequence ENSEMBL: ENSMUSP00000112428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000058358] [ENSMUST00000117274] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000132086] [ENSMUST00000144248] [ENSMUST00000154571]
Predicted Effect probably null
Transcript: ENSMUST00000037472
AA Change: Y562*
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: Y562*

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058358
SMART Domains Protein: ENSMUSP00000061079
Gene: ENSMUSG00000043432

DomainStartEndE-ValueType
ZnF_C3H1 8 34 1.72e-4 SMART
Pfam:DUF504 77 128 1.9e-11 PFAM
Pfam:AKAP7_NLS 305 484 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117274
SMART Domains Protein: ENSMUSP00000113223
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121270
AA Change: Y562*
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545
AA Change: Y562*

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably benign
Transcript: ENSMUST00000128756
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132086
SMART Domains Protein: ENSMUSP00000121129
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 29 51 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144248
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect probably benign
Transcript: ENSMUST00000154571
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Meta Mutation Damage Score 0.6124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4145482 missense probably benign 0.03
IGL02437:Leng8 APN 7 4142093 missense probably damaging 0.99
R0104:Leng8 UTSW 7 4143808 missense probably damaging 0.99
R0774:Leng8 UTSW 7 4142136 missense probably damaging 1.00
R1696:Leng8 UTSW 7 4145136 missense probably damaging 1.00
R2001:Leng8 UTSW 7 4145074 missense probably damaging 1.00
R2012:Leng8 UTSW 7 4143610 missense probably damaging 1.00
R3433:Leng8 UTSW 7 4142132 missense probably benign 0.22
R4335:Leng8 UTSW 7 4147038 missense probably damaging 0.99
R4607:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4608:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4886:Leng8 UTSW 7 4144931 unclassified probably null
R5307:Leng8 UTSW 7 4145473 missense probably damaging 1.00
R5339:Leng8 UTSW 7 4145286 missense possibly damaging 0.96
R5368:Leng8 UTSW 7 4139988 missense probably damaging 0.97
R5370:Leng8 UTSW 7 4145434 missense possibly damaging 0.48
R5615:Leng8 UTSW 7 4144958 nonsense probably null
R5645:Leng8 UTSW 7 4145274 missense probably damaging 1.00
R5750:Leng8 UTSW 7 4142120 missense probably benign 0.04
R6041:Leng8 UTSW 7 4145569 missense probably benign 0.01
R6054:Leng8 UTSW 7 4145523 unclassified probably null
R6481:Leng8 UTSW 7 4145413 missense probably damaging 1.00
R6826:Leng8 UTSW 7 4145320 missense probably damaging 1.00
R6919:Leng8 UTSW 7 4143626 missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4139526 missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4144933 nonsense probably null
R7428:Leng8 UTSW 7 4143573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCCCAGACATGACCTAGC -3'
(R):5'- AGATGTGAAGGGCCTGCATG -3'

Sequencing Primer
(F):5'- ACTGGAGTGCGAGGACC -3'
(R):5'- CATGCTAGGATTTTTCTCAGCCAGAG -3'
Posted On2014-09-17