Incidental Mutation 'R0148:Nod1'
ID22652
Institutional Source Beutler Lab
Gene Symbol Nod1
Ensembl Gene ENSMUSG00000038058
Gene Namenucleotide-binding oligomerization domain containing 1
SynonymsCard4, F830007N14Rik, Nlrc1
MMRRC Submission 038432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0148 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location54923949-54972612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54938217 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 764 (Y764H)
Ref Sequence ENSEMBL: ENSMUSP00000130487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060655] [ENSMUST00000168172] [ENSMUST00000203076]
Predicted Effect probably damaging
Transcript: ENSMUST00000060655
AA Change: Y764H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055747
Gene: ENSMUSG00000038058
AA Change: Y764H

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 4.7e-21 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 1.3e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168172
AA Change: Y764H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130487
Gene: ENSMUSG00000038058
AA Change: Y764H

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 7.6e-20 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 6.2e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203076
SMART Domains Protein: ENSMUSP00000145123
Gene: ENSMUSG00000038058

DomainStartEndE-ValueType
low complexity region 82 91 N/A INTRINSIC
LRR 101 128 5.3e-3 SMART
LRR 157 184 4.8e-4 SMART
LRR 185 212 1.7e-6 SMART
LRR 213 240 6.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205242
Meta Mutation Damage Score 0.3099 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 86% (30/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice were viable, fertile, and appeared normal in a specific-pathogen free environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,662,446 probably null Het
Agtr1a T C 13: 30,381,944 S331P probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Bahcc1 A T 11: 120,268,404 Q152H probably damaging Het
Bend3 T A 10: 43,511,950 Y780N probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Efl1 T C 7: 82,671,670 S104P probably damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fbln1 G A 15: 85,230,826 R193H probably damaging Het
Fbxw21 A G 9: 109,148,017 probably null Het
Fgf17 C T 14: 70,638,873 R49Q probably damaging Het
Flnb T C 14: 7,939,077 S2307P probably benign Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Git1 A G 11: 77,505,728 T601A probably benign Het
Gm10722 T "C,A" 9: 3,001,405 probably null Het
Gm5142 C T 14: 59,178,670 R13H possibly damaging Het
Gria2 A C 3: 80,707,731 W481G probably damaging Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Il4ra T A 7: 125,575,537 C306S probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Lama3 G A 18: 12,448,272 C596Y probably damaging Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
March6 C T 15: 31,490,612 V293M probably damaging Het
Med12l A G 3: 59,037,654 D100G probably damaging Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mrpl53 T C 6: 83,109,537 L74P probably damaging Het
Mvp C T 7: 126,989,865 V577M probably damaging Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nipsnap3b C T 4: 53,017,088 A104V possibly damaging Het
Nlrp14 A G 7: 107,182,721 Y375C probably benign Het
Olfr225 G A 11: 59,613,494 V177M probably damaging Het
Olfr270 A T 4: 52,971,232 I204F probably benign Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Peg10 C A 6: 4,755,711 R96S possibly damaging Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rilp A T 11: 75,510,233 H29L probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Ryr1 C A 7: 29,052,035 R3706L probably damaging Het
Ryr2 T C 13: 11,714,548 D2396G probably damaging Het
Slc45a2 T C 15: 11,025,868 S435P probably damaging Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tep1 A T 14: 50,824,789 D2535E possibly damaging Het
Tkt T A 14: 30,572,220 I529N probably damaging Het
Trp53i11 T G 2: 93,197,735 V39G probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Usp3 A G 9: 66,540,167 V219A possibly damaging Het
Usp4 T A 9: 108,391,671 probably null Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Xkr6 T C 14: 63,819,549 V303A unknown Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfhx2 A G 14: 55,072,897 Y731H possibly damaging Het
Other mutations in Nod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Nod1 APN 6 54944946 missense probably damaging 1.00
IGL00937:Nod1 APN 6 54937364 missense probably benign 0.08
IGL00945:Nod1 APN 6 54944586 unclassified probably null
IGL01410:Nod1 APN 6 54944356 missense probably damaging 1.00
IGL02094:Nod1 APN 6 54939390 splice site probably null
IGL02217:Nod1 APN 6 54943419 missense possibly damaging 0.63
IGL02573:Nod1 APN 6 54943945 missense probably benign 0.02
IGL02944:Nod1 APN 6 54924947 missense possibly damaging 0.68
R0092:Nod1 UTSW 6 54944541 missense probably damaging 1.00
R0108:Nod1 UTSW 6 54943749 missense probably benign 0.27
R0771:Nod1 UTSW 6 54944269 missense probably damaging 0.96
R1493:Nod1 UTSW 6 54944056 missense probably damaging 1.00
R1540:Nod1 UTSW 6 54943975 missense probably benign 0.09
R1660:Nod1 UTSW 6 54944233 unclassified probably null
R1710:Nod1 UTSW 6 54944059 missense probably damaging 0.98
R1911:Nod1 UTSW 6 54944440 missense probably damaging 0.96
R2008:Nod1 UTSW 6 54939325 missense probably damaging 1.00
R3409:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3410:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3927:Nod1 UTSW 6 54944917 missense probably benign 0.01
R4499:Nod1 UTSW 6 54943996 missense probably damaging 1.00
R4608:Nod1 UTSW 6 54943756 missense probably damaging 1.00
R5552:Nod1 UTSW 6 54944631 missense probably damaging 1.00
R5667:Nod1 UTSW 6 54933576 missense probably benign 0.06
R5859:Nod1 UTSW 6 54930177 missense probably benign 0.08
R5868:Nod1 UTSW 6 54939327 missense probably damaging 1.00
R5995:Nod1 UTSW 6 54944554 missense probably damaging 0.99
R6329:Nod1 UTSW 6 54944704 missense probably benign 0.00
R6331:Nod1 UTSW 6 54924983 missense probably damaging 1.00
R6642:Nod1 UTSW 6 54948029 missense probably damaging 1.00
R6798:Nod1 UTSW 6 54944611 missense probably damaging 0.97
R6889:Nod1 UTSW 6 54944109 missense probably benign 0.27
R7582:Nod1 UTSW 6 54944307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACTGGGTCATAATTCCTCCAC -3'
(R):5'- CAGAAGGGAAGTCTGACTTTGGAGC -3'

Sequencing Primer
(F):5'- GGGTCATAATTCCTCCACAGGATG -3'
(R):5'- ACTTTGGAGCCAGGCTGAG -3'
Posted On2013-04-16