Incidental Mutation 'R2054:Cnot1'
ID226524
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95739841 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1589 (S1589R)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: S1584R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: S1584R

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: S1589R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: S1589R

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: S1582R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212712
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: S1589R

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCTTGACATGCTGATCTAAC -3'
(R):5'- AGCTGGGCATTTTAGCAGG -3'

Sequencing Primer
(F):5'- CAAAGATCAGTTGTAACCAATGGC -3'
(R):5'- AGTTTGAGACCAGCCTGATC -3'
Posted On2014-09-17