Incidental Mutation 'R2054:Supt6'
ID226532
Institutional Source Beutler Lab
Gene Symbol Supt6
Ensembl Gene ENSMUSG00000002052
Gene Namesuppressor of Ty 6
SynonymsSPT6, Supt6h, 5131400N11Rik
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78206746-78245987 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 78224361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121]
Predicted Effect probably benign
Transcript: ENSMUST00000002121
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during pre-implantation development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Supt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Supt6 APN 11 78231181 missense possibly damaging 0.94
IGL01457:Supt6 APN 11 78221143 missense probably damaging 1.00
IGL01608:Supt6 APN 11 78225483 missense probably damaging 1.00
IGL01739:Supt6 APN 11 78222187 missense probably damaging 1.00
IGL01765:Supt6 APN 11 78222159 missense probably benign 0.09
IGL01894:Supt6 APN 11 78222838 missense probably benign 0.00
IGL01952:Supt6 APN 11 78225760 missense probably benign 0.01
IGL02067:Supt6 APN 11 78231157 missense probably benign 0.01
IGL02244:Supt6 APN 11 78232797 missense possibly damaging 0.92
IGL02267:Supt6 APN 11 78226204 missense possibly damaging 0.72
IGL02379:Supt6 APN 11 78225369 missense possibly damaging 0.75
IGL02541:Supt6 APN 11 78226918 missense probably damaging 0.99
IGL02635:Supt6 APN 11 78212739 missense probably damaging 1.00
IGL03347:Supt6 APN 11 78232185 missense possibly damaging 0.71
IGL02980:Supt6 UTSW 11 78225722 missense probably damaging 1.00
IGL02991:Supt6 UTSW 11 78225353 missense probably damaging 1.00
R0145:Supt6 UTSW 11 78208236 missense probably benign 0.22
R0371:Supt6 UTSW 11 78223157 missense probably benign 0.00
R0452:Supt6 UTSW 11 78227003 missense probably damaging 1.00
R0464:Supt6 UTSW 11 78216338 missense probably benign 0.33
R0616:Supt6 UTSW 11 78209495 missense probably damaging 1.00
R0653:Supt6 UTSW 11 78226015 missense probably benign 0.01
R0788:Supt6 UTSW 11 78207772 unclassified probably benign
R1103:Supt6 UTSW 11 78225473 missense possibly damaging 0.59
R1282:Supt6 UTSW 11 78228768 missense possibly damaging 0.83
R1460:Supt6 UTSW 11 78222198 missense possibly damaging 0.93
R1508:Supt6 UTSW 11 78216203 critical splice donor site probably null
R1850:Supt6 UTSW 11 78219877 splice site probably benign
R1854:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R1855:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R2098:Supt6 UTSW 11 78213261 splice site probably null
R2146:Supt6 UTSW 11 78230932 missense probably damaging 1.00
R2167:Supt6 UTSW 11 78208167 missense possibly damaging 0.94
R4621:Supt6 UTSW 11 78212746 missense possibly damaging 0.65
R4734:Supt6 UTSW 11 78224683 missense probably benign 0.01
R4825:Supt6 UTSW 11 78208134 missense possibly damaging 0.84
R5575:Supt6 UTSW 11 78228961 missense probably damaging 1.00
R5789:Supt6 UTSW 11 78233586 missense unknown
R5889:Supt6 UTSW 11 78212748 missense probably damaging 0.98
R6296:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6297:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6394:Supt6 UTSW 11 78231065 missense probably damaging 1.00
R6702:Supt6 UTSW 11 78231800 missense possibly damaging 0.93
R6737:Supt6 UTSW 11 78231818 missense probably damaging 0.99
R6751:Supt6 UTSW 11 78208949 missense probably benign 0.09
R6853:Supt6 UTSW 11 78232830 missense possibly damaging 0.85
R7213:Supt6 UTSW 11 78232150 missense probably damaging 1.00
R7259:Supt6 UTSW 11 78207616 missense probably damaging 0.99
R7609:Supt6 UTSW 11 78226951 missense probably benign 0.01
R7776:Supt6 UTSW 11 78209529 missense probably damaging 0.99
X0067:Supt6 UTSW 11 78232675 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTACAATGGGGATCAGAGCCG -3'
(R):5'- TGCTAACTGTTGCGCTGTTC -3'

Sequencing Primer
(F):5'- AATCTCTGCGAGTTCAAGGC -3'
(R):5'- GTTCTCTCCGTGGCTGGC -3'
Posted On2014-09-17