Incidental Mutation 'R2054:Tff2'
ID 226551
Institutional Source Beutler Lab
Gene Symbol Tff2
Ensembl Gene ENSMUSG00000024028
Gene Name trefoil factor 2 (spasmolytic protein 1)
Synonyms SP, mSP
MMRRC Submission 040059-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R2054 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 31360036-31363256 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31362199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 40 (K40E)
Ref Sequence ENSEMBL: ENSMUSP00000024826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024826]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024826
AA Change: K40E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028
AA Change: K40E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PD 29 76 1.44e-16 SMART
PD 79 125 6.94e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased gastric proliferation, increased acid secretion, increased susceptibility to gastric ulceration after indomethacin administration, and altered regulation of genes involved in adaptive and immune responses in the pyloric antrum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,728,562 (GRCm39) C94S possibly damaging Het
A930011G23Rik T C 5: 99,375,914 (GRCm39) Y432C probably benign Het
Abtb2 A G 2: 103,535,462 (GRCm39) D543G probably benign Het
Adam9 A T 8: 25,481,310 (GRCm39) V318E probably damaging Het
Aim2 T C 1: 173,291,548 (GRCm39) F318L probably damaging Het
Apob A T 12: 8,063,134 (GRCm39) D3872V probably damaging Het
Atat1 T A 17: 36,212,261 (GRCm39) R323W probably null Het
Atp2b4 T C 1: 133,642,907 (GRCm39) D1066G probably benign Het
Bltp1 A G 3: 37,002,002 (GRCm39) T1316A probably benign Het
Caskin2 T C 11: 115,697,127 (GRCm39) probably benign Het
Cblif G A 19: 11,736,370 (GRCm39) V314I probably benign Het
Ccdc54 T A 16: 50,410,987 (GRCm39) N93I probably damaging Het
Ccnd1 A C 7: 144,491,128 (GRCm39) D159E possibly damaging Het
Cnot1 A C 8: 96,466,469 (GRCm39) S1589R possibly damaging Het
Copa T A 1: 171,946,524 (GRCm39) Y980* probably null Het
Defb19 A G 2: 152,418,090 (GRCm39) I82T possibly damaging Het
Elapor2 C A 5: 9,513,030 (GRCm39) T1008K possibly damaging Het
Fiz1 G A 7: 5,011,235 (GRCm39) R428C probably damaging Het
Fnip2 A T 3: 79,479,772 (GRCm39) probably benign Het
Gabrb3 G A 7: 57,474,241 (GRCm39) G408S probably benign Het
Hao1 C T 2: 134,340,178 (GRCm39) silent Het
Hecw1 T A 13: 14,471,998 (GRCm39) M557L probably damaging Het
Itch A T 2: 155,052,496 (GRCm39) I699F probably damaging Het
Kmt2a T C 9: 44,734,671 (GRCm39) probably benign Het
Leng8 T G 7: 4,147,289 (GRCm39) Y562* probably null Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrp1b A T 2: 40,587,494 (GRCm39) N151K unknown Het
Lrrc71 T C 3: 87,649,980 (GRCm39) E316G probably damaging Het
Mgat5 A G 1: 127,325,344 (GRCm39) N404D probably damaging Het
Mrps26 C A 2: 130,406,087 (GRCm39) T100K probably benign Het
Mtor A G 4: 148,547,309 (GRCm39) T431A probably benign Het
Mtor T A 4: 148,550,482 (GRCm39) C713S probably benign Het
Mug2 A G 6: 122,054,451 (GRCm39) K1077E probably damaging Het
Nbas A G 12: 13,524,207 (GRCm39) T1688A probably benign Het
Nek2 T C 1: 191,553,764 (GRCm39) S3P possibly damaging Het
Nell2 T C 15: 95,332,990 (GRCm39) T190A probably benign Het
Npr2 A T 4: 43,646,560 (GRCm39) N636I probably damaging Het
Orc3 A T 4: 34,584,846 (GRCm39) I453K probably damaging Het
Pcnx1 A G 12: 81,980,448 (GRCm39) H865R probably benign Het
Pex1 T C 5: 3,653,341 (GRCm39) V80A possibly damaging Het
Phka2 T A X: 159,337,323 (GRCm39) D424E probably damaging Het
Pkd1 C T 17: 24,793,770 (GRCm39) T1819I probably benign Het
Poglut1 T C 16: 38,355,169 (GRCm39) D219G probably damaging Het
Ppargc1a T C 5: 51,631,130 (GRCm39) I500V possibly damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Pygm C G 19: 6,438,185 (GRCm39) N163K probably benign Het
Qrich1 T A 9: 108,436,469 (GRCm39) N722K possibly damaging Het
Reep6 T A 10: 80,166,156 (GRCm39) C104* probably null Het
Rfx8 A G 1: 39,724,719 (GRCm39) V214A possibly damaging Het
Sis G A 3: 72,820,570 (GRCm39) T1398I probably benign Het
Skint5 A G 4: 113,676,360 (GRCm39) probably null Het
Slc7a14 A G 3: 31,291,511 (GRCm39) probably benign Het
Smc2 T A 4: 52,462,948 (GRCm39) M646K probably benign Het
Snx29 A G 16: 11,449,356 (GRCm39) N165S probably damaging Het
Supt6 T A 11: 78,115,187 (GRCm39) probably benign Het
Tead4 G T 6: 128,247,925 (GRCm39) S37R probably damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tex56 T A 13: 35,108,574 (GRCm39) Y19N probably damaging Het
Traip C T 9: 107,840,118 (GRCm39) T265M probably benign Het
Trim47 T C 11: 115,999,109 (GRCm39) T256A probably benign Het
Trpm1 A G 7: 63,890,303 (GRCm39) M853V possibly damaging Het
Tti1 G T 2: 157,849,365 (GRCm39) Q625K possibly damaging Het
Ube2n A G 10: 95,377,128 (GRCm39) N31S probably damaging Het
Vmn2r17 T C 5: 109,600,352 (GRCm39) M550T probably damaging Het
Zfp512 T A 5: 31,622,793 (GRCm39) N31K probably benign Het
Zfp64 A G 2: 168,767,728 (GRCm39) V628A probably damaging Het
Other mutations in Tff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Tff2 APN 17 31,362,240 (GRCm39) splice site probably null
IGL01486:Tff2 APN 17 31,361,316 (GRCm39) missense probably benign 0.37
R1270:Tff2 UTSW 17 31,363,143 (GRCm39) critical splice donor site probably null
R2107:Tff2 UTSW 17 31,361,256 (GRCm39) missense possibly damaging 0.50
R6163:Tff2 UTSW 17 31,363,152 (GRCm39) missense probably benign 0.25
R6754:Tff2 UTSW 17 31,363,207 (GRCm39) missense probably benign 0.06
R7187:Tff2 UTSW 17 31,361,200 (GRCm39) missense probably damaging 1.00
R8899:Tff2 UTSW 17 31,362,113 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCGTGTTAACCTGGGCTAG -3'
(R):5'- TGGGCAAAATAAGACCTCATGTC -3'

Sequencing Primer
(F):5'- TAGCTCAGCTAGGCTTCCAAG -3'
(R):5'- GACCTCATGTCACCCCTTGGG -3'
Posted On 2014-09-17