Incidental Mutation 'R2054:Atat1'
ID226552
Institutional Source Beutler Lab
Gene Symbol Atat1
Ensembl Gene ENSMUSG00000024426
Gene Namealpha tubulin acetyltransferase 1
Synonyms2610110G12Rik, 0610011P08Rik, 3110080J08Rik, 2610008K08Rik
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35897595-35910075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35901369 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 323 (R323W)
Ref Sequence ENSEMBL: ENSMUSP00000122715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056034] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000141132] [ENSMUST00000141662] [ENSMUST00000146451] [ENSMUST00000148482] [ENSMUST00000148721] [ENSMUST00000149277] [ENSMUST00000150056] [ENSMUST00000156817]
Predicted Effect probably null
Transcript: ENSMUST00000056034
AA Change: S300C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053853
Gene: ENSMUSG00000024426
AA Change: S300C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061052
AA Change: R323W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426
AA Change: R323W

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077494
AA Change: R300W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426
AA Change: R300W

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126744
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137069
Predicted Effect probably null
Transcript: ENSMUST00000140292
AA Change: S117C
SMART Domains Protein: ENSMUSP00000119039
Gene: ENSMUSG00000024426
AA Change: S117C

DomainStartEndE-ValueType
PDB:4GS4|A 2 36 9e-13 PDB
low complexity region 50 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140990
Predicted Effect probably benign
Transcript: ENSMUST00000141132
SMART Domains Protein: ENSMUSP00000117824
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
Pfam:Mec-17 29 149 9.1e-59 PFAM
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141662
AA Change: S323C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115004
Gene: ENSMUSG00000024426
AA Change: S323C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.7e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143114
Predicted Effect probably benign
Transcript: ENSMUST00000146451
SMART Domains Protein: ENSMUSP00000115771
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148482
SMART Domains Protein: ENSMUSP00000114151
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148721
SMART Domains Protein: ENSMUSP00000116278
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 28 79 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF2358 149 274 1.4e-36 PFAM
low complexity region 289 302 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149277
AA Change: R323W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426
AA Change: R323W

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149452
Predicted Effect probably benign
Transcript: ENSMUST00000150056
SMART Domains Protein: ENSMUSP00000121142
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 130 5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154272
Predicted Effect probably benign
Transcript: ENSMUST00000156817
SMART Domains Protein: ENSMUSP00000114851
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 16 60 N/A INTRINSIC
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired alpha tubulin acetylation and abnormal dentate gyrus morphology. Mice homozygous for a different knock-out allele exhibit reduced male fertility associated with teratozoospermia, oligozoospermia andasthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Atat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Atat1 APN 17 35897883 missense probably benign 0.04
IGL01903:Atat1 APN 17 35897800 missense probably benign 0.00
IGL01958:Atat1 APN 17 35908843 unclassified probably benign
IGL02725:Atat1 APN 17 35909489 missense probably benign 0.01
IGL02729:Atat1 APN 17 35898391 missense probably benign 0.00
R0633:Atat1 UTSW 17 35901423 missense probably damaging 1.00
R1541:Atat1 UTSW 17 35904331 missense probably damaging 1.00
R1944:Atat1 UTSW 17 35909340 missense probably damaging 1.00
R2132:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R4967:Atat1 UTSW 17 35901575 missense probably damaging 1.00
R6062:Atat1 UTSW 17 35908564 missense probably damaging 1.00
R6347:Atat1 UTSW 17 35910029 missense probably damaging 1.00
R6380:Atat1 UTSW 17 35908957 unclassified probably null
R7010:Atat1 UTSW 17 35908630 missense probably damaging 1.00
R7028:Atat1 UTSW 17 35910005 missense probably benign 0.01
R7230:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R7520:Atat1 UTSW 17 35897814 missense probably benign 0.36
R7607:Atat1 UTSW 17 35909107 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGGTCCATGGCTCCATATAAAG -3'
(R):5'- TCCTGAAGGTAGCTGTGGAG -3'

Sequencing Primer
(F):5'- GCTCCATATAAAGCCCCCAC -3'
(R):5'- TCCTTGGCCCCTGAACAG -3'
Posted On2014-09-17