Incidental Mutation 'R2054:Gif'
ID226554
Institutional Source Beutler Lab
Gene Symbol Gif
Ensembl Gene ENSMUSG00000024682
Gene Namegastric intrinsic factor
Synonyms
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11747554-11763447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11759006 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 314 (V314I)
Ref Sequence ENSEMBL: ENSMUSP00000025585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025585]
Predicted Effect probably benign
Transcript: ENSMUST00000025585
AA Change: V314I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025585
Gene: ENSMUSG00000024682
AA Change: V314I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 8 308 2.6e-110 PFAM
Pfam:DUF4430 340 416 7.7e-9 PFAM
Meta Mutation Damage Score 0.1602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cobalamin transport protein family. It encodes a glycoprotein secreted by parietal cells of the gastric mucosa and is required for adequate absorption of vitamin B12. Vitamin B12 is necessary for erythrocyte maturation and mutations in this gene may lead to congenital pernicious anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit vitamin B12-sensitive susceptibility to bacterial infection and reduced body weight and altered blood chemistry that can be compensated by maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Gif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Gif APN 19 11757762 missense probably benign 0.40
IGL02466:Gif APN 19 11752232 missense probably damaging 1.00
IGL02678:Gif APN 19 11748475 missense probably damaging 1.00
IGL02955:Gif APN 19 11747663 missense possibly damaging 0.93
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0135:Gif UTSW 19 11757754 missense probably damaging 1.00
R0606:Gif UTSW 19 11752294 missense possibly damaging 0.80
R1758:Gif UTSW 19 11757815 missense probably damaging 1.00
R1885:Gif UTSW 19 11752324 missense probably benign
R3087:Gif UTSW 19 11760373 nonsense probably null
R4004:Gif UTSW 19 11759007 missense probably damaging 1.00
R4601:Gif UTSW 19 11752190 missense probably damaging 1.00
R4888:Gif UTSW 19 11752219 missense probably benign 0.16
R5546:Gif UTSW 19 11748495 missense possibly damaging 0.95
R5795:Gif UTSW 19 11760376 missense probably damaging 0.99
R6136:Gif UTSW 19 11750285 missense probably damaging 0.98
R6147:Gif UTSW 19 11747572 start gained probably benign
R7342:Gif UTSW 19 11763223 missense probably benign 0.00
R7814:Gif UTSW 19 11750187 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCCAGGACTCTAGAGTAGTTG -3'
(R):5'- AATCTGAGTCAGGCTTGGGG -3'

Sequencing Primer
(F):5'- GCAATGACTTTTGCAGC -3'
(R):5'- CTTGGGGAGGGCAACGTTG -3'
Posted On2014-09-17