Incidental Mutation 'R2055:Kiz'
ID226568
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission 040060-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2055 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146891283 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 460 (Q460K)
Ref Sequence ENSEMBL: ENSMUSP00000096884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably benign
Transcript: ENSMUST00000099278
AA Change: Q460K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: Q460K

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156232
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,845 E185G probably damaging Het
3425401B19Rik A G 14: 32,662,551 S486P probably benign Het
4931408C20Rik A T 1: 26,685,732 N122K possibly damaging Het
A630023A22Rik T C 14: 34,052,750 probably benign Het
Abca1 T C 4: 53,069,881 N1271S probably benign Het
AI597479 C T 1: 43,111,120 A130V probably benign Het
Angptl4 A G 17: 33,780,524 probably null Het
Arhgef25 T A 10: 127,185,135 N294I probably damaging Het
Atp2b1 T C 10: 99,014,559 V848A probably damaging Het
Bard1 T C 1: 71,074,872 T317A probably benign Het
C1rl T C 6: 124,493,822 W30R probably benign Het
Cchcr1 A G 17: 35,526,420 E379G probably damaging Het
Cfap36 G T 11: 29,247,122 A3E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca4a A G 3: 144,970,728 Y64H probably damaging Het
Cops5 A G 1: 10,032,337 probably null Het
Cracr2a G T 6: 127,608,601 E121* probably null Het
Cstf1 A G 2: 172,380,483 E387G probably benign Het
D630044L22Rik A C 17: 25,961,977 D733E probably damaging Het
Dlc1 A T 8: 36,593,381 C514S probably damaging Het
Dmwd G T 7: 19,076,685 R139L probably benign Het
Dnah17 A T 11: 118,067,531 S2709T probably benign Het
Dnmt3a T C 12: 3,872,859 I154T probably benign Het
Dpp7 T C 2: 25,354,478 N297S possibly damaging Het
Ern2 A T 7: 122,183,945 V34D possibly damaging Het
Erp27 A G 6: 136,908,229 probably benign Het
F2 T C 2: 91,628,442 T508A probably benign Het
Fam181b A G 7: 93,080,426 T136A probably benign Het
Fam227b C A 2: 126,100,954 V308L probably benign Het
Fbxw20 A T 9: 109,221,374 H394Q probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Glt8d1 T G 14: 31,009,736 S111A probably benign Het
Gm11146 A T 16: 77,595,081 probably benign Het
Gm5724 A T 6: 141,725,455 H430Q probably benign Het
Grip1 C T 10: 120,049,511 probably benign Het
H2-Q2 A T 17: 35,345,271 T334S probably benign Het
Hcrtr1 A G 4: 130,130,887 V402A probably benign Het
Hmcn2 C A 2: 31,378,282 A1130D probably benign Het
Hsd17b2 T C 8: 117,702,174 L60P possibly damaging Het
Htr1f A T 16: 64,926,035 I298N probably damaging Het
Ighmbp2 G T 19: 3,265,095 A775D probably benign Het
Kcnn3 A G 3: 89,521,375 T303A probably damaging Het
Krt75 C T 15: 101,572,761 V193I probably benign Het
Lsp1 G A 7: 142,489,407 probably null Het
Mfsd12 A G 10: 81,360,229 H146R probably damaging Het
Mmp23 T C 4: 155,651,987 K199R possibly damaging Het
Naip2 A G 13: 100,179,372 V300A probably benign Het
Nbeal1 C T 1: 60,311,057 L2422F probably damaging Het
Nbeal2 G T 9: 110,635,307 D1094E possibly damaging Het
Nckap5 T C 1: 126,026,898 E639G probably damaging Het
Nr4a3 A G 4: 48,067,771 I456V possibly damaging Het
Olfr224 A G 11: 58,566,847 F166S probably damaging Het
Parp9 G T 16: 35,953,614 V86L probably damaging Het
Phactr1 A G 13: 43,077,940 N386S probably damaging Het
Pold2 A T 11: 5,873,516 Y304* probably null Het
Pou5f2 A G 13: 78,025,821 Y294C probably benign Het
Rars A G 11: 35,826,583 probably benign Het
Rbm12b1 A G 4: 12,145,606 E526G probably benign Het
Sacs T C 14: 61,214,049 Y4515H probably damaging Het
Sdk2 C A 11: 113,850,954 R813L probably damaging Het
Six5 T C 7: 19,095,229 V198A possibly damaging Het
Spn A G 7: 127,137,216 S40P probably damaging Het
Ssr1 A G 13: 37,987,785 probably benign Het
Tlr6 C A 5: 64,953,926 C546F probably damaging Het
Top1 T A 2: 160,702,828 probably benign Het
Trhr2 A G 8: 122,358,793 S151P probably damaging Het
Tubb2b T G 13: 34,127,725 K362Q probably benign Het
Unc13c T C 9: 73,736,550 T1211A probably damaging Het
Vmn1r15 T C 6: 57,258,744 V199A possibly damaging Het
Vnn1 A G 10: 23,900,577 probably benign Het
Vps41 T A 13: 18,854,616 N737K possibly damaging Het
Vps50 T A 6: 3,522,265 N144K probably benign Het
Zc3h7a A T 16: 11,137,476 N911K probably benign Het
Zkscan7 T A 9: 122,888,937 S132R probably damaging Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ATCTGATTCTAGAGAGTCTGGCC -3'
(R):5'- CCACTGTTCAGTGACACTTAAAC -3'

Sequencing Primer
(F):5'- CGCACTGTCGAATCCAGGAG -3'
(R):5'- AGCTACCTTAAAATTTGCAAAAAGG -3'
Posted On2014-09-17