Incidental Mutation 'R2055:Nr4a3'
ID226575
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 040060-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2055 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48067771 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 456 (I456V)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030025
AA Change: I456V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: I456V

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153369
AA Change: I485V
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: I485V

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Meta Mutation Damage Score 0.2527 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,845 E185G probably damaging Het
3425401B19Rik A G 14: 32,662,551 S486P probably benign Het
4931408C20Rik A T 1: 26,685,732 N122K possibly damaging Het
A630023A22Rik T C 14: 34,052,750 probably benign Het
Abca1 T C 4: 53,069,881 N1271S probably benign Het
AI597479 C T 1: 43,111,120 A130V probably benign Het
Angptl4 A G 17: 33,780,524 probably null Het
Arhgef25 T A 10: 127,185,135 N294I probably damaging Het
Atp2b1 T C 10: 99,014,559 V848A probably damaging Het
Bard1 T C 1: 71,074,872 T317A probably benign Het
C1rl T C 6: 124,493,822 W30R probably benign Het
Cchcr1 A G 17: 35,526,420 E379G probably damaging Het
Cfap36 G T 11: 29,247,122 A3E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca4a A G 3: 144,970,728 Y64H probably damaging Het
Cops5 A G 1: 10,032,337 probably null Het
Cracr2a G T 6: 127,608,601 E121* probably null Het
Cstf1 A G 2: 172,380,483 E387G probably benign Het
D630044L22Rik A C 17: 25,961,977 D733E probably damaging Het
Dlc1 A T 8: 36,593,381 C514S probably damaging Het
Dmwd G T 7: 19,076,685 R139L probably benign Het
Dnah17 A T 11: 118,067,531 S2709T probably benign Het
Dnmt3a T C 12: 3,872,859 I154T probably benign Het
Dpp7 T C 2: 25,354,478 N297S possibly damaging Het
Ern2 A T 7: 122,183,945 V34D possibly damaging Het
Erp27 A G 6: 136,908,229 probably benign Het
F2 T C 2: 91,628,442 T508A probably benign Het
Fam181b A G 7: 93,080,426 T136A probably benign Het
Fam227b C A 2: 126,100,954 V308L probably benign Het
Fbxw20 A T 9: 109,221,374 H394Q probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Glt8d1 T G 14: 31,009,736 S111A probably benign Het
Gm11146 A T 16: 77,595,081 probably benign Het
Gm5724 A T 6: 141,725,455 H430Q probably benign Het
Grip1 C T 10: 120,049,511 probably benign Het
H2-Q2 A T 17: 35,345,271 T334S probably benign Het
Hcrtr1 A G 4: 130,130,887 V402A probably benign Het
Hmcn2 C A 2: 31,378,282 A1130D probably benign Het
Hsd17b2 T C 8: 117,702,174 L60P possibly damaging Het
Htr1f A T 16: 64,926,035 I298N probably damaging Het
Ighmbp2 G T 19: 3,265,095 A775D probably benign Het
Kcnn3 A G 3: 89,521,375 T303A probably damaging Het
Kiz C A 2: 146,891,283 Q460K probably benign Het
Krt75 C T 15: 101,572,761 V193I probably benign Het
Lsp1 G A 7: 142,489,407 probably null Het
Mfsd12 A G 10: 81,360,229 H146R probably damaging Het
Mmp23 T C 4: 155,651,987 K199R possibly damaging Het
Naip2 A G 13: 100,179,372 V300A probably benign Het
Nbeal1 C T 1: 60,311,057 L2422F probably damaging Het
Nbeal2 G T 9: 110,635,307 D1094E possibly damaging Het
Nckap5 T C 1: 126,026,898 E639G probably damaging Het
Olfr224 A G 11: 58,566,847 F166S probably damaging Het
Parp9 G T 16: 35,953,614 V86L probably damaging Het
Phactr1 A G 13: 43,077,940 N386S probably damaging Het
Pold2 A T 11: 5,873,516 Y304* probably null Het
Pou5f2 A G 13: 78,025,821 Y294C probably benign Het
Rars A G 11: 35,826,583 probably benign Het
Rbm12b1 A G 4: 12,145,606 E526G probably benign Het
Sacs T C 14: 61,214,049 Y4515H probably damaging Het
Sdk2 C A 11: 113,850,954 R813L probably damaging Het
Six5 T C 7: 19,095,229 V198A possibly damaging Het
Spn A G 7: 127,137,216 S40P probably damaging Het
Ssr1 A G 13: 37,987,785 probably benign Het
Tlr6 C A 5: 64,953,926 C546F probably damaging Het
Top1 T A 2: 160,702,828 probably benign Het
Trhr2 A G 8: 122,358,793 S151P probably damaging Het
Tubb2b T G 13: 34,127,725 K362Q probably benign Het
Unc13c T C 9: 73,736,550 T1211A probably damaging Het
Vmn1r15 T C 6: 57,258,744 V199A possibly damaging Het
Vnn1 A G 10: 23,900,577 probably benign Het
Vps41 T A 13: 18,854,616 N737K possibly damaging Het
Vps50 T A 6: 3,522,265 N144K probably benign Het
Zc3h7a A T 16: 11,137,476 N911K probably benign Het
Zkscan7 T A 9: 122,888,937 S132R probably damaging Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGAGCCAGTCTTCAATGGTG -3'
(R):5'- TCAGACTAGAACCCAGGGTC -3'

Sequencing Primer
(F):5'- CCAGTCTTCAATGGTGGTGCC -3'
(R):5'- TAGAACCCAGGGTCCCAGC -3'
Posted On2014-09-17