Incidental Mutation 'R2055:Abca1'
ID226576
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 040060-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2055 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53069881 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1271 (N1271S)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: N1271S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: N1271S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,845 E185G probably damaging Het
3425401B19Rik A G 14: 32,662,551 S486P probably benign Het
4931408C20Rik A T 1: 26,685,732 N122K possibly damaging Het
A630023A22Rik T C 14: 34,052,750 probably benign Het
AI597479 C T 1: 43,111,120 A130V probably benign Het
Angptl4 A G 17: 33,780,524 probably null Het
Arhgef25 T A 10: 127,185,135 N294I probably damaging Het
Atp2b1 T C 10: 99,014,559 V848A probably damaging Het
Bard1 T C 1: 71,074,872 T317A probably benign Het
C1rl T C 6: 124,493,822 W30R probably benign Het
Cchcr1 A G 17: 35,526,420 E379G probably damaging Het
Cfap36 G T 11: 29,247,122 A3E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca4a A G 3: 144,970,728 Y64H probably damaging Het
Cops5 A G 1: 10,032,337 probably null Het
Cracr2a G T 6: 127,608,601 E121* probably null Het
Cstf1 A G 2: 172,380,483 E387G probably benign Het
D630044L22Rik A C 17: 25,961,977 D733E probably damaging Het
Dlc1 A T 8: 36,593,381 C514S probably damaging Het
Dmwd G T 7: 19,076,685 R139L probably benign Het
Dnah17 A T 11: 118,067,531 S2709T probably benign Het
Dnmt3a T C 12: 3,872,859 I154T probably benign Het
Dpp7 T C 2: 25,354,478 N297S possibly damaging Het
Ern2 A T 7: 122,183,945 V34D possibly damaging Het
Erp27 A G 6: 136,908,229 probably benign Het
F2 T C 2: 91,628,442 T508A probably benign Het
Fam181b A G 7: 93,080,426 T136A probably benign Het
Fam227b C A 2: 126,100,954 V308L probably benign Het
Fbxw20 A T 9: 109,221,374 H394Q probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Glt8d1 T G 14: 31,009,736 S111A probably benign Het
Gm11146 A T 16: 77,595,081 probably benign Het
Gm5724 A T 6: 141,725,455 H430Q probably benign Het
Grip1 C T 10: 120,049,511 probably benign Het
H2-Q2 A T 17: 35,345,271 T334S probably benign Het
Hcrtr1 A G 4: 130,130,887 V402A probably benign Het
Hmcn2 C A 2: 31,378,282 A1130D probably benign Het
Hsd17b2 T C 8: 117,702,174 L60P possibly damaging Het
Htr1f A T 16: 64,926,035 I298N probably damaging Het
Ighmbp2 G T 19: 3,265,095 A775D probably benign Het
Kcnn3 A G 3: 89,521,375 T303A probably damaging Het
Kiz C A 2: 146,891,283 Q460K probably benign Het
Krt75 C T 15: 101,572,761 V193I probably benign Het
Lsp1 G A 7: 142,489,407 probably null Het
Mfsd12 A G 10: 81,360,229 H146R probably damaging Het
Mmp23 T C 4: 155,651,987 K199R possibly damaging Het
Naip2 A G 13: 100,179,372 V300A probably benign Het
Nbeal1 C T 1: 60,311,057 L2422F probably damaging Het
Nbeal2 G T 9: 110,635,307 D1094E possibly damaging Het
Nckap5 T C 1: 126,026,898 E639G probably damaging Het
Nr4a3 A G 4: 48,067,771 I456V possibly damaging Het
Olfr224 A G 11: 58,566,847 F166S probably damaging Het
Parp9 G T 16: 35,953,614 V86L probably damaging Het
Phactr1 A G 13: 43,077,940 N386S probably damaging Het
Pold2 A T 11: 5,873,516 Y304* probably null Het
Pou5f2 A G 13: 78,025,821 Y294C probably benign Het
Rars A G 11: 35,826,583 probably benign Het
Rbm12b1 A G 4: 12,145,606 E526G probably benign Het
Sacs T C 14: 61,214,049 Y4515H probably damaging Het
Sdk2 C A 11: 113,850,954 R813L probably damaging Het
Six5 T C 7: 19,095,229 V198A possibly damaging Het
Spn A G 7: 127,137,216 S40P probably damaging Het
Ssr1 A G 13: 37,987,785 probably benign Het
Tlr6 C A 5: 64,953,926 C546F probably damaging Het
Top1 T A 2: 160,702,828 probably benign Het
Trhr2 A G 8: 122,358,793 S151P probably damaging Het
Tubb2b T G 13: 34,127,725 K362Q probably benign Het
Unc13c T C 9: 73,736,550 T1211A probably damaging Het
Vmn1r15 T C 6: 57,258,744 V199A possibly damaging Het
Vnn1 A G 10: 23,900,577 probably benign Het
Vps41 T A 13: 18,854,616 N737K possibly damaging Het
Vps50 T A 6: 3,522,265 N144K probably benign Het
Zc3h7a A T 16: 11,137,476 N911K probably benign Het
Zkscan7 T A 9: 122,888,937 S132R probably damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
R7863:Abca1 UTSW 4 53107179 missense probably benign
R7877:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
R7946:Abca1 UTSW 4 53107179 missense probably benign
R7960:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAAGGGGCTCTCTCATCTTTTC -3'
(R):5'- TGCACACTGGGTAGGCTTTC -3'

Sequencing Primer
(F):5'- CTGTGATCTTAACCAAAGGCG -3'
(R):5'- CACACTGGGTAGGCTTTCTGTTG -3'
Posted On2014-09-17