Mutagenetix > Incidental Mutations

Incidental Mutation 'R0148:Il4ra'

22659

Institutional Source

Beutler Lab

Gene Symbol

Il4ra

Ensembl Gene

ENSMUSG00000030748

Gene Name

interleukin 4 receptor, alpha

Synonyms

Il4r, IL-4 receptor alpha chain, CD124

MMRRC Submission

038432-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R0148 (G1)

Quality Score

183

Status

Validated (trace)

Chromosome

Chromosomal Location

125552120-125579474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 125575537 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 306 (C306S)

Ref Sequence

ENSEMBL: ENSMUSP00000033004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000206846]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033004
AA Change: C306S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748
AA Change: C306S

Domain	Start	End	E-Value	Type
Pfam:IL4Ra_N	28	122	9.9e-39	PFAM
FN3	124	211	3.14e0	SMART
low complexity region	369	385	N/A	INTRINSIC
low complexity region	562	574	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	635	647	N/A	INTRINSIC
low complexity region	674	683	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205394

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206681

Predicted Effect

probably benign
Transcript: ENSMUST00000206846

Meta Mutation Damage Score

0.2147

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

86% (30/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,662,446		probably null	Het
Agtr1a	T	C	13: 30,381,944	S331P	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Bahcc1	A	T	11: 120,268,404	Q152H	probably damaging	Het
Bend3	T	A	10: 43,511,950	Y780N	probably damaging	Het
Bod1l	G	T	5: 41,818,697	A1758E	possibly damaging	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dock8	T	C	19: 25,119,459	L577P	probably benign	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Efl1	T	C	7: 82,671,670	S104P	probably damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fbln1	G	A	15: 85,230,826	R193H	probably damaging	Het
Fbxw21	A	G	9: 109,148,017		probably null	Het
Fgf17	C	T	14: 70,638,873	R49Q	probably damaging	Het
Flnb	T	C	14: 7,939,077	S2307P	probably benign	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Git1	A	G	11: 77,505,728	T601A	probably benign	Het
Gm10722	T	"C,A"	9: 3,001,405		probably null	Het
Gm5142	C	T	14: 59,178,670	R13H	possibly damaging	Het
Gria2	A	C	3: 80,707,731	W481G	probably damaging	Het
Homer2	T	C	7: 81,624,278	T57A	probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Lama3	G	A	18: 12,448,272	C596Y	probably damaging	Het
Lama5	T	C	2: 180,190,406	H1714R	probably benign	Het
March6	C	T	15: 31,490,612	V293M	probably damaging	Het
Med12l	A	G	3: 59,037,654	D100G	probably damaging	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mrpl53	T	C	6: 83,109,537	L74P	probably damaging	Het
Mvp	C	T	7: 126,989,865	V577M	probably damaging	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nipsnap3b	C	T	4: 53,017,088	A104V	possibly damaging	Het
Nlrp14	A	G	7: 107,182,721	Y375C	probably benign	Het
Nod1	A	G	6: 54,938,217	Y764H	probably damaging	Het
Olfr225	G	A	11: 59,613,494	V177M	probably damaging	Het
Olfr270	A	T	4: 52,971,232	I204F	probably benign	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Peg10	C	A	6: 4,755,711	R96S	possibly damaging	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rgs11	T	A	17: 26,207,459		probably null	Het
Rilp	A	T	11: 75,510,233	H29L	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Ryr1	C	A	7: 29,052,035	R3706L	probably damaging	Het
Ryr2	T	C	13: 11,714,548	D2396G	probably damaging	Het
Slc45a2	T	C	15: 11,025,868	S435P	probably damaging	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tep1	A	T	14: 50,824,789	D2535E	possibly damaging	Het
Tkt	T	A	14: 30,572,220	I529N	probably damaging	Het
Trp53i11	T	G	2: 93,197,735	V39G	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Usp3	A	G	9: 66,540,167	V219A	possibly damaging	Het
Usp4	T	A	9: 108,391,671		probably null	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Xkr6	T	C	14: 63,819,549	V303A	unknown	Het
Zdbf2	C	T	1: 63,304,006	Q515*	probably null	Het
Zfhx2	A	G	14: 55,072,897	Y731H	possibly damaging	Het

Other mutations in Il4ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Il4ra	APN	7	125569175	critical splice donor site	probably null
IGL01067:Il4ra	APN	7	125575161	missense	probably benign	0.09
IGL01107:Il4ra	APN	7	125575914	missense	possibly damaging	0.88
IGL02224:Il4ra	APN	7	125570099	splice site	probably benign
IGL02249:Il4ra	APN	7	125567224	missense	probably benign	0.01
IGL02383:Il4ra	APN	7	125571504	missense	probably benign	0.06
IGL02614:Il4ra	APN	7	125575790	nonsense	probably null
IGL02879:Il4ra	APN	7	125576897	missense	possibly damaging	0.88
Haile	UTSW	7	125574717	critical splice donor site	probably null
Lowe	UTSW	7	125567221	missense	probably damaging	1.00
BB006:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
BB016:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
IGL02991:Il4ra	UTSW	7	125575661	missense	possibly damaging	0.70
PIT4418001:Il4ra	UTSW	7	125576338	missense	probably benign	0.01
R0066:Il4ra	UTSW	7	125576231	missense	possibly damaging	0.80
R0127:Il4ra	UTSW	7	125569070	missense	probably damaging	1.00
R0238:Il4ra	UTSW	7	125575199	splice site	probably benign
R0239:Il4ra	UTSW	7	125575199	splice site	probably benign
R0884:Il4ra	UTSW	7	125574663	missense	probably damaging	1.00
R1102:Il4ra	UTSW	7	125574717	critical splice donor site	probably null
R1622:Il4ra	UTSW	7	125570053	missense	possibly damaging	0.87
R1773:Il4ra	UTSW	7	125567182	missense	possibly damaging	0.94
R4510:Il4ra	UTSW	7	125576108	missense	possibly damaging	0.63
R4511:Il4ra	UTSW	7	125576108	missense	possibly damaging	0.63
R4612:Il4ra	UTSW	7	125576083	missense	probably benign	0.14
R5865:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
R5996:Il4ra	UTSW	7	125567221	missense	probably damaging	1.00
R6057:Il4ra	UTSW	7	125571563	missense	probably damaging	1.00
R6246:Il4ra	UTSW	7	125576405	missense	probably benign	0.00
R7218:Il4ra	UTSW	7	125575778	missense	probably benign	0.01
R7624:Il4ra	UTSW	7	125569108	missense	probably damaging	1.00
R7904:Il4ra	UTSW	7	125565673	missense	probably benign	0.05
R7929:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
R8360:Il4ra	UTSW	7	125569966	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGGTGGCAATCAATTCCCCTTC -3'
(R):5'- GTGACATGCTCAGGTCCTCTTTGAC -3'

Sequencing Primer
(F):5'- AATCATGGGTGGCTGAGTCTC -3'
(R):5'- CCACATTCTGTACTGGGGC -3'

Posted On

2013-04-16