Incidental Mutation 'R2055:Rars'
ID226610
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
Synonyms
MMRRC Submission 040060-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2055 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 35826583 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect probably benign
Transcript: ENSMUST00000018992
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848

DomainStartEndE-ValueType
Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166122
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,845 E185G probably damaging Het
3425401B19Rik A G 14: 32,662,551 S486P probably benign Het
4931408C20Rik A T 1: 26,685,732 N122K possibly damaging Het
A630023A22Rik T C 14: 34,052,750 probably benign Het
Abca1 T C 4: 53,069,881 N1271S probably benign Het
AI597479 C T 1: 43,111,120 A130V probably benign Het
Angptl4 A G 17: 33,780,524 probably null Het
Arhgef25 T A 10: 127,185,135 N294I probably damaging Het
Atp2b1 T C 10: 99,014,559 V848A probably damaging Het
Bard1 T C 1: 71,074,872 T317A probably benign Het
C1rl T C 6: 124,493,822 W30R probably benign Het
Cchcr1 A G 17: 35,526,420 E379G probably damaging Het
Cfap36 G T 11: 29,247,122 A3E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca4a A G 3: 144,970,728 Y64H probably damaging Het
Cops5 A G 1: 10,032,337 probably null Het
Cracr2a G T 6: 127,608,601 E121* probably null Het
Cstf1 A G 2: 172,380,483 E387G probably benign Het
D630044L22Rik A C 17: 25,961,977 D733E probably damaging Het
Dlc1 A T 8: 36,593,381 C514S probably damaging Het
Dmwd G T 7: 19,076,685 R139L probably benign Het
Dnah17 A T 11: 118,067,531 S2709T probably benign Het
Dnmt3a T C 12: 3,872,859 I154T probably benign Het
Dpp7 T C 2: 25,354,478 N297S possibly damaging Het
Ern2 A T 7: 122,183,945 V34D possibly damaging Het
Erp27 A G 6: 136,908,229 probably benign Het
F2 T C 2: 91,628,442 T508A probably benign Het
Fam181b A G 7: 93,080,426 T136A probably benign Het
Fam227b C A 2: 126,100,954 V308L probably benign Het
Fbxw20 A T 9: 109,221,374 H394Q probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Glt8d1 T G 14: 31,009,736 S111A probably benign Het
Gm11146 A T 16: 77,595,081 probably benign Het
Gm5724 A T 6: 141,725,455 H430Q probably benign Het
Grip1 C T 10: 120,049,511 probably benign Het
H2-Q2 A T 17: 35,345,271 T334S probably benign Het
Hcrtr1 A G 4: 130,130,887 V402A probably benign Het
Hmcn2 C A 2: 31,378,282 A1130D probably benign Het
Hsd17b2 T C 8: 117,702,174 L60P possibly damaging Het
Htr1f A T 16: 64,926,035 I298N probably damaging Het
Ighmbp2 G T 19: 3,265,095 A775D probably benign Het
Kcnn3 A G 3: 89,521,375 T303A probably damaging Het
Kiz C A 2: 146,891,283 Q460K probably benign Het
Krt75 C T 15: 101,572,761 V193I probably benign Het
Lsp1 G A 7: 142,489,407 probably null Het
Mfsd12 A G 10: 81,360,229 H146R probably damaging Het
Mmp23 T C 4: 155,651,987 K199R possibly damaging Het
Naip2 A G 13: 100,179,372 V300A probably benign Het
Nbeal1 C T 1: 60,311,057 L2422F probably damaging Het
Nbeal2 G T 9: 110,635,307 D1094E possibly damaging Het
Nckap5 T C 1: 126,026,898 E639G probably damaging Het
Nr4a3 A G 4: 48,067,771 I456V possibly damaging Het
Olfr224 A G 11: 58,566,847 F166S probably damaging Het
Parp9 G T 16: 35,953,614 V86L probably damaging Het
Phactr1 A G 13: 43,077,940 N386S probably damaging Het
Pold2 A T 11: 5,873,516 Y304* probably null Het
Pou5f2 A G 13: 78,025,821 Y294C probably benign Het
Rbm12b1 A G 4: 12,145,606 E526G probably benign Het
Sacs T C 14: 61,214,049 Y4515H probably damaging Het
Sdk2 C A 11: 113,850,954 R813L probably damaging Het
Six5 T C 7: 19,095,229 V198A possibly damaging Het
Spn A G 7: 127,137,216 S40P probably damaging Het
Ssr1 A G 13: 37,987,785 probably benign Het
Tlr6 C A 5: 64,953,926 C546F probably damaging Het
Top1 T A 2: 160,702,828 probably benign Het
Trhr2 A G 8: 122,358,793 S151P probably damaging Het
Tubb2b T G 13: 34,127,725 K362Q probably benign Het
Unc13c T C 9: 73,736,550 T1211A probably damaging Het
Vmn1r15 T C 6: 57,258,744 V199A possibly damaging Het
Vnn1 A G 10: 23,900,577 probably benign Het
Vps41 T A 13: 18,854,616 N737K possibly damaging Het
Vps50 T A 6: 3,522,265 N144K probably benign Het
Zc3h7a A T 16: 11,137,476 N911K probably benign Het
Zkscan7 T A 9: 122,888,937 S132R probably damaging Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1193:Rars UTSW 11 35809326 missense possibly damaging 0.92
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2294:Rars UTSW 11 35817536 splice site probably benign
R4281:Rars UTSW 11 35821224 missense probably damaging 1.00
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6550:Rars UTSW 11 35833183 missense probably benign 0.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7822:Rars UTSW 11 35819966 missense probably damaging 0.99
R7856:Rars UTSW 11 35808585 missense probably benign 0.09
R7939:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTAGGCAAGGACAGCACTTG -3'
(R):5'- CCCTGCATTTGTGAAAGTGGATG -3'

Sequencing Primer
(F):5'- GGACAGCACTTGCAGGTCTAAC -3'
(R):5'- CAGTAAGCAGCCGGGTTCAG -3'
Posted On2014-09-17