Incidental Mutation 'R2055:Glt8d1'
ID226622
Institutional Source Beutler Lab
Gene Symbol Glt8d1
Ensembl Gene ENSMUSG00000021916
Gene Nameglycosyltransferase 8 domain containing 1
Synonyms
MMRRC Submission 040060-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2055 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31001400-31011991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31009736 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 111 (S111A)
Ref Sequence ENSEMBL: ENSMUSP00000129323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022476] [ENSMUST00000037739] [ENSMUST00000168584] [ENSMUST00000226378] [ENSMUST00000226740]
Predicted Effect probably benign
Transcript: ENSMUST00000022476
AA Change: S111A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022476
Gene: ENSMUSG00000021916
AA Change: S111A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037739
SMART Domains Protein: ENSMUSP00000047119
Gene: ENSMUSG00000042354

DomainStartEndE-ValueType
Pfam:GN3L_Grn1 16 90 4.3e-25 PFAM
low complexity region 112 126 N/A INTRINSIC
SCOP:d1egaa1 130 207 3e-3 SMART
low complexity region 209 220 N/A INTRINSIC
Pfam:MMR_HSR1 251 362 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104024
Predicted Effect probably benign
Transcript: ENSMUST00000168584
AA Change: S111A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129323
Gene: ENSMUSG00000021916
AA Change: S111A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 8.6e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226348
Predicted Effect probably benign
Transcript: ENSMUST00000226378
Predicted Effect probably benign
Transcript: ENSMUST00000226379
Predicted Effect probably benign
Transcript: ENSMUST00000226740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228914
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyltransferase family. The encoded protein is a type II transmembrane protein containing a glycosyltransferase 8 domain in the lumenal (C-terminal) portion. The specific function of this protein has not been determined. Two alternatively spliced variants encoding the same isoform have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display exhibited impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,845 E185G probably damaging Het
3425401B19Rik A G 14: 32,662,551 S486P probably benign Het
4931408C20Rik A T 1: 26,685,732 N122K possibly damaging Het
A630023A22Rik T C 14: 34,052,750 probably benign Het
Abca1 T C 4: 53,069,881 N1271S probably benign Het
AI597479 C T 1: 43,111,120 A130V probably benign Het
Angptl4 A G 17: 33,780,524 probably null Het
Arhgef25 T A 10: 127,185,135 N294I probably damaging Het
Atp2b1 T C 10: 99,014,559 V848A probably damaging Het
Bard1 T C 1: 71,074,872 T317A probably benign Het
C1rl T C 6: 124,493,822 W30R probably benign Het
Cchcr1 A G 17: 35,526,420 E379G probably damaging Het
Cfap36 G T 11: 29,247,122 A3E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca4a A G 3: 144,970,728 Y64H probably damaging Het
Cops5 A G 1: 10,032,337 probably null Het
Cracr2a G T 6: 127,608,601 E121* probably null Het
Cstf1 A G 2: 172,380,483 E387G probably benign Het
D630044L22Rik A C 17: 25,961,977 D733E probably damaging Het
Dlc1 A T 8: 36,593,381 C514S probably damaging Het
Dmwd G T 7: 19,076,685 R139L probably benign Het
Dnah17 A T 11: 118,067,531 S2709T probably benign Het
Dnmt3a T C 12: 3,872,859 I154T probably benign Het
Dpp7 T C 2: 25,354,478 N297S possibly damaging Het
Ern2 A T 7: 122,183,945 V34D possibly damaging Het
Erp27 A G 6: 136,908,229 probably benign Het
F2 T C 2: 91,628,442 T508A probably benign Het
Fam181b A G 7: 93,080,426 T136A probably benign Het
Fam227b C A 2: 126,100,954 V308L probably benign Het
Fbxw20 A T 9: 109,221,374 H394Q probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm11146 A T 16: 77,595,081 probably benign Het
Gm5724 A T 6: 141,725,455 H430Q probably benign Het
Grip1 C T 10: 120,049,511 probably benign Het
H2-Q2 A T 17: 35,345,271 T334S probably benign Het
Hcrtr1 A G 4: 130,130,887 V402A probably benign Het
Hmcn2 C A 2: 31,378,282 A1130D probably benign Het
Hsd17b2 T C 8: 117,702,174 L60P possibly damaging Het
Htr1f A T 16: 64,926,035 I298N probably damaging Het
Ighmbp2 G T 19: 3,265,095 A775D probably benign Het
Kcnn3 A G 3: 89,521,375 T303A probably damaging Het
Kiz C A 2: 146,891,283 Q460K probably benign Het
Krt75 C T 15: 101,572,761 V193I probably benign Het
Lsp1 G A 7: 142,489,407 probably null Het
Mfsd12 A G 10: 81,360,229 H146R probably damaging Het
Mmp23 T C 4: 155,651,987 K199R possibly damaging Het
Naip2 A G 13: 100,179,372 V300A probably benign Het
Nbeal1 C T 1: 60,311,057 L2422F probably damaging Het
Nbeal2 G T 9: 110,635,307 D1094E possibly damaging Het
Nckap5 T C 1: 126,026,898 E639G probably damaging Het
Nr4a3 A G 4: 48,067,771 I456V possibly damaging Het
Olfr224 A G 11: 58,566,847 F166S probably damaging Het
Parp9 G T 16: 35,953,614 V86L probably damaging Het
Phactr1 A G 13: 43,077,940 N386S probably damaging Het
Pold2 A T 11: 5,873,516 Y304* probably null Het
Pou5f2 A G 13: 78,025,821 Y294C probably benign Het
Rars A G 11: 35,826,583 probably benign Het
Rbm12b1 A G 4: 12,145,606 E526G probably benign Het
Sacs T C 14: 61,214,049 Y4515H probably damaging Het
Sdk2 C A 11: 113,850,954 R813L probably damaging Het
Six5 T C 7: 19,095,229 V198A possibly damaging Het
Spn A G 7: 127,137,216 S40P probably damaging Het
Ssr1 A G 13: 37,987,785 probably benign Het
Tlr6 C A 5: 64,953,926 C546F probably damaging Het
Top1 T A 2: 160,702,828 probably benign Het
Trhr2 A G 8: 122,358,793 S151P probably damaging Het
Tubb2b T G 13: 34,127,725 K362Q probably benign Het
Unc13c T C 9: 73,736,550 T1211A probably damaging Het
Vmn1r15 T C 6: 57,258,744 V199A possibly damaging Het
Vnn1 A G 10: 23,900,577 probably benign Het
Vps41 T A 13: 18,854,616 N737K possibly damaging Het
Vps50 T A 6: 3,522,265 N144K probably benign Het
Zc3h7a A T 16: 11,137,476 N911K probably benign Het
Zkscan7 T A 9: 122,888,937 S132R probably damaging Het
Other mutations in Glt8d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Glt8d1 APN 14 31008810 missense probably damaging 1.00
IGL03087:Glt8d1 APN 14 31010096 missense probably damaging 1.00
R0494:Glt8d1 UTSW 14 31011623 missense possibly damaging 0.87
R0531:Glt8d1 UTSW 14 31006504 missense probably benign 0.00
R0594:Glt8d1 UTSW 14 31010410 critical splice donor site probably null
R1540:Glt8d1 UTSW 14 31011592 missense probably benign 0.00
R1715:Glt8d1 UTSW 14 31011521 missense possibly damaging 0.95
R3081:Glt8d1 UTSW 14 31006660 missense probably benign
R4676:Glt8d1 UTSW 14 31006692 missense probably benign
R7143:Glt8d1 UTSW 14 31006645 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCCATCGATTCTTGGTTGAGAAG -3'
(R):5'- CCCTAGGGAAGTACTTGCAC -3'

Sequencing Primer
(F):5'- AAGGAGCTTTGGTGGAAATACCTTC -3'
(R):5'- GTACTTGCACTGTATAGCCAGAGTC -3'
Posted On2014-09-17