Incidental Mutation 'R2066:Or4c113'
ID 226645
Institutional Source Beutler Lab
Gene Symbol Or4c113
Ensembl Gene ENSMUSG00000075105
Gene Name olfactory receptor family 4 subfamily C member 113
Synonyms GA_x6K02T2Q125-50536041-50535106, Olfr1218, MOR233-12
MMRRC Submission 040071-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2066 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 88884833-88885768 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88885243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 176 (Y176H)
Ref Sequence ENSEMBL: ENSMUSP00000149671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099798] [ENSMUST00000213609] [ENSMUST00000215048] [ENSMUST00000215054]
AlphaFold L7MU54
Predicted Effect probably damaging
Transcript: ENSMUST00000099798
AA Change: Y176H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097386
Gene: ENSMUSG00000075105
AA Change: Y176H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.4e-45 PFAM
Pfam:7tm_1 39 286 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213609
AA Change: Y176H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215048
AA Change: Y176H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215054
AA Change: Y176H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Acadl C T 1: 66,880,905 (GRCm39) probably null Het
Acss1 G A 2: 150,510,051 (GRCm39) Q23* probably null Het
Afap1l1 A T 18: 61,872,193 (GRCm39) probably null Het
Akt3 A G 1: 176,930,551 (GRCm39) S136P possibly damaging Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ano5 T G 7: 51,235,134 (GRCm39) L639R probably damaging Het
Arhgap26 T C 18: 39,439,781 (GRCm39) S71P probably damaging Het
B3gnt2 A G 11: 22,786,735 (GRCm39) L151P probably damaging Het
Bach1 A T 16: 87,526,513 (GRCm39) K658N probably damaging Het
Bdnf C A 2: 109,554,247 (GRCm39) T207K probably damaging Het
Bod1l G T 5: 41,962,499 (GRCm39) T2746K probably damaging Het
Brwd1 A G 16: 95,847,665 (GRCm39) S652P probably benign Het
Ccnt1 A T 15: 98,449,823 (GRCm39) H156Q probably benign Het
Clasp2 T A 9: 113,735,225 (GRCm39) I1021N possibly damaging Het
Cnep1r1 G T 8: 88,845,445 (GRCm39) probably benign Het
Cntn6 C T 6: 104,838,783 (GRCm39) R946* probably null Het
Dnaaf3 T C 7: 4,526,798 (GRCm39) I426M possibly damaging Het
Dnajc13 A T 9: 104,098,640 (GRCm39) I471N probably benign Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Emx2 A G 19: 59,450,130 (GRCm39) N149S probably benign Het
Fbln7 G T 2: 128,719,386 (GRCm39) R61L probably damaging Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Filip1 A G 9: 79,727,498 (GRCm39) S374P probably damaging Het
Fry T A 5: 150,293,584 (GRCm39) probably benign Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm2959 A G 14: 42,235,658 (GRCm39) noncoding transcript Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Hdlbp A G 1: 93,349,602 (GRCm39) probably benign Het
Hunk G A 16: 90,278,133 (GRCm39) probably null Het
Ifnb1 T A 4: 88,440,996 (GRCm39) I6F possibly damaging Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Ints1 A G 5: 139,753,251 (GRCm39) V720A probably benign Het
Invs T A 4: 48,396,287 (GRCm39) L320Q probably damaging Het
Jpt2 G A 17: 25,167,713 (GRCm39) Q79* probably null Het
Lingo2 A G 4: 35,709,179 (GRCm39) L267P probably benign Het
Lonp2 A G 8: 87,392,403 (GRCm39) T490A probably damaging Het
Meiob G T 17: 25,037,290 (GRCm39) R56L probably damaging Het
Mindy3 A T 2: 12,424,060 (GRCm39) S2T probably damaging Het
Mrm3 A T 11: 76,141,147 (GRCm39) D385V probably damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Naf1 A G 8: 67,340,432 (GRCm39) D414G probably damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Nbea A G 3: 55,875,567 (GRCm39) V1701A probably damaging Het
Nipal4 T G 11: 46,047,622 (GRCm39) D104A probably damaging Het
Npas4 A G 19: 5,037,442 (GRCm39) V284A probably damaging Het
Nup133 C A 8: 124,641,314 (GRCm39) D869Y probably damaging Het
Obscn G A 11: 59,026,558 (GRCm39) A215V possibly damaging Het
Or8b12i G T 9: 20,082,850 (GRCm39) Q6K probably benign Het
Or8g24 T C 9: 38,989,510 (GRCm39) Y177C probably damaging Het
Pgs1 G A 11: 117,905,396 (GRCm39) probably benign Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Phldb2 A T 16: 45,591,121 (GRCm39) L970Q probably damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Ppip5k1 A G 2: 121,173,352 (GRCm39) probably benign Het
Prune2 A G 19: 17,098,042 (GRCm39) D1182G possibly damaging Het
Psg25 G A 7: 18,263,487 (GRCm39) T112I probably damaging Het
Sec61g T C 11: 16,458,124 (GRCm39) T24A probably benign Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Sorbs1 T C 19: 40,353,472 (GRCm39) probably null Het
Sox2 C A 3: 34,705,456 (GRCm39) Q298K possibly damaging Het
Spatc1 T A 15: 76,167,737 (GRCm39) probably null Het
Szt2 T C 4: 118,231,177 (GRCm39) M2529V unknown Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Tpp2 T G 1: 44,017,598 (GRCm39) I734S possibly damaging Het
Troap T C 15: 98,980,344 (GRCm39) L508P probably benign Het
Ttc28 C A 5: 111,373,799 (GRCm39) F1078L probably benign Het
Ttn T C 2: 76,544,717 (GRCm39) N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Ugt2b36 T C 5: 87,240,100 (GRCm39) E95G probably benign Het
Vmn1r55 A G 7: 5,150,048 (GRCm39) V125A possibly damaging Het
Vstm2a A T 11: 16,211,483 (GRCm39) I98F probably benign Het
Zdhhc13 T A 7: 48,466,175 (GRCm39) V284D probably benign Het
Zfp668 C A 7: 127,466,203 (GRCm39) R327L probably damaging Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Or4c113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Or4c113 APN 2 88,884,913 (GRCm39) missense probably damaging 1.00
IGL03089:Or4c113 APN 2 88,885,357 (GRCm39) missense probably benign 0.34
IGL03387:Or4c113 APN 2 88,885,457 (GRCm39) missense probably damaging 1.00
R0350:Or4c113 UTSW 2 88,885,700 (GRCm39) missense probably benign 0.10
R0699:Or4c113 UTSW 2 88,885,636 (GRCm39) missense possibly damaging 0.67
R1609:Or4c113 UTSW 2 88,885,688 (GRCm39) missense probably benign
R1856:Or4c113 UTSW 2 88,885,203 (GRCm39) missense possibly damaging 0.95
R1972:Or4c113 UTSW 2 88,884,891 (GRCm39) missense probably benign 0.05
R2921:Or4c113 UTSW 2 88,884,843 (GRCm39) missense probably benign 0.04
R2923:Or4c113 UTSW 2 88,884,843 (GRCm39) missense probably benign 0.04
R4037:Or4c113 UTSW 2 88,885,032 (GRCm39) missense probably damaging 0.99
R4585:Or4c113 UTSW 2 88,885,498 (GRCm39) missense possibly damaging 0.77
R4586:Or4c113 UTSW 2 88,885,498 (GRCm39) missense possibly damaging 0.77
R5041:Or4c113 UTSW 2 88,885,265 (GRCm39) nonsense probably null
R5124:Or4c113 UTSW 2 88,885,431 (GRCm39) missense probably damaging 0.96
R5138:Or4c113 UTSW 2 88,885,291 (GRCm39) missense probably benign 0.00
R5415:Or4c113 UTSW 2 88,885,240 (GRCm39) missense probably benign 0.00
R5501:Or4c113 UTSW 2 88,885,230 (GRCm39) nonsense probably null
R5941:Or4c113 UTSW 2 88,884,963 (GRCm39) missense probably benign
R5991:Or4c113 UTSW 2 88,885,126 (GRCm39) missense probably benign 0.01
R6396:Or4c113 UTSW 2 88,885,641 (GRCm39) missense probably benign 0.36
R7047:Or4c113 UTSW 2 88,885,490 (GRCm39) missense probably damaging 0.98
R8038:Or4c113 UTSW 2 88,885,212 (GRCm39) missense probably damaging 1.00
R8387:Or4c113 UTSW 2 88,885,646 (GRCm39) missense probably benign
R8403:Or4c113 UTSW 2 88,884,948 (GRCm39) missense probably benign 0.00
R8794:Or4c113 UTSW 2 88,885,477 (GRCm39) missense probably benign
R8907:Or4c113 UTSW 2 88,885,542 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACTACAACAGTAACGTGGGC -3'
(R):5'- TAGCAGCCATGGCCTATGAC -3'

Sequencing Primer
(F):5'- GAAAGAGCTTTCCTTCGTCCTTCAG -3'
(R):5'- CCGCTACGTGGCTATTTGCAAG -3'
Posted On 2014-09-17