Incidental Mutation 'R2066:Ugt2b36'
ID 226671
Institutional Source Beutler Lab
Gene Symbol Ugt2b36
Ensembl Gene ENSMUSG00000070704
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B36
Synonyms
MMRRC Submission 040071-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R2066 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 87213786-87240414 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87240100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 95 (E95G)
Ref Sequence ENSEMBL: ENSMUSP00000123024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094649] [ENSMUST00000132667] [ENSMUST00000145617]
AlphaFold Q3UEP4
Predicted Effect probably benign
Transcript: ENSMUST00000094649
AA Change: E95G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092233
Gene: ENSMUSG00000070704
AA Change: E95G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 6.9e-260 PFAM
Pfam:Glyco_tran_28_C 339 448 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132667
AA Change: E95G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123024
Gene: ENSMUSG00000070704
AA Change: E95G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 105 1.1e-23 PFAM
Pfam:UDPGT 99 265 7.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145617
SMART Domains Protein: ENSMUSP00000120005
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 22 249 2.1e-127 PFAM
Pfam:Glyco_tran_28_C 164 245 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154455
SMART Domains Protein: ENSMUSP00000120633
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 1 198 1.2e-117 PFAM
Pfam:Glyco_tran_28_C 109 194 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199725
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Acadl C T 1: 66,880,905 (GRCm39) probably null Het
Acss1 G A 2: 150,510,051 (GRCm39) Q23* probably null Het
Afap1l1 A T 18: 61,872,193 (GRCm39) probably null Het
Akt3 A G 1: 176,930,551 (GRCm39) S136P possibly damaging Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ano5 T G 7: 51,235,134 (GRCm39) L639R probably damaging Het
Arhgap26 T C 18: 39,439,781 (GRCm39) S71P probably damaging Het
B3gnt2 A G 11: 22,786,735 (GRCm39) L151P probably damaging Het
Bach1 A T 16: 87,526,513 (GRCm39) K658N probably damaging Het
Bdnf C A 2: 109,554,247 (GRCm39) T207K probably damaging Het
Bod1l G T 5: 41,962,499 (GRCm39) T2746K probably damaging Het
Brwd1 A G 16: 95,847,665 (GRCm39) S652P probably benign Het
Ccnt1 A T 15: 98,449,823 (GRCm39) H156Q probably benign Het
Clasp2 T A 9: 113,735,225 (GRCm39) I1021N possibly damaging Het
Cnep1r1 G T 8: 88,845,445 (GRCm39) probably benign Het
Cntn6 C T 6: 104,838,783 (GRCm39) R946* probably null Het
Dnaaf3 T C 7: 4,526,798 (GRCm39) I426M possibly damaging Het
Dnajc13 A T 9: 104,098,640 (GRCm39) I471N probably benign Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Emx2 A G 19: 59,450,130 (GRCm39) N149S probably benign Het
Fbln7 G T 2: 128,719,386 (GRCm39) R61L probably damaging Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Filip1 A G 9: 79,727,498 (GRCm39) S374P probably damaging Het
Fry T A 5: 150,293,584 (GRCm39) probably benign Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm2959 A G 14: 42,235,658 (GRCm39) noncoding transcript Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Hdlbp A G 1: 93,349,602 (GRCm39) probably benign Het
Hunk G A 16: 90,278,133 (GRCm39) probably null Het
Ifnb1 T A 4: 88,440,996 (GRCm39) I6F possibly damaging Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Ints1 A G 5: 139,753,251 (GRCm39) V720A probably benign Het
Invs T A 4: 48,396,287 (GRCm39) L320Q probably damaging Het
Jpt2 G A 17: 25,167,713 (GRCm39) Q79* probably null Het
Lingo2 A G 4: 35,709,179 (GRCm39) L267P probably benign Het
Lonp2 A G 8: 87,392,403 (GRCm39) T490A probably damaging Het
Meiob G T 17: 25,037,290 (GRCm39) R56L probably damaging Het
Mindy3 A T 2: 12,424,060 (GRCm39) S2T probably damaging Het
Mrm3 A T 11: 76,141,147 (GRCm39) D385V probably damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Naf1 A G 8: 67,340,432 (GRCm39) D414G probably damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Nbea A G 3: 55,875,567 (GRCm39) V1701A probably damaging Het
Nipal4 T G 11: 46,047,622 (GRCm39) D104A probably damaging Het
Npas4 A G 19: 5,037,442 (GRCm39) V284A probably damaging Het
Nup133 C A 8: 124,641,314 (GRCm39) D869Y probably damaging Het
Obscn G A 11: 59,026,558 (GRCm39) A215V possibly damaging Het
Or4c113 A G 2: 88,885,243 (GRCm39) Y176H probably damaging Het
Or8b12i G T 9: 20,082,850 (GRCm39) Q6K probably benign Het
Or8g24 T C 9: 38,989,510 (GRCm39) Y177C probably damaging Het
Pgs1 G A 11: 117,905,396 (GRCm39) probably benign Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Phldb2 A T 16: 45,591,121 (GRCm39) L970Q probably damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Ppip5k1 A G 2: 121,173,352 (GRCm39) probably benign Het
Prune2 A G 19: 17,098,042 (GRCm39) D1182G possibly damaging Het
Psg25 G A 7: 18,263,487 (GRCm39) T112I probably damaging Het
Sec61g T C 11: 16,458,124 (GRCm39) T24A probably benign Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Sorbs1 T C 19: 40,353,472 (GRCm39) probably null Het
Sox2 C A 3: 34,705,456 (GRCm39) Q298K possibly damaging Het
Spatc1 T A 15: 76,167,737 (GRCm39) probably null Het
Szt2 T C 4: 118,231,177 (GRCm39) M2529V unknown Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Tpp2 T G 1: 44,017,598 (GRCm39) I734S possibly damaging Het
Troap T C 15: 98,980,344 (GRCm39) L508P probably benign Het
Ttc28 C A 5: 111,373,799 (GRCm39) F1078L probably benign Het
Ttn T C 2: 76,544,717 (GRCm39) N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Vmn1r55 A G 7: 5,150,048 (GRCm39) V125A possibly damaging Het
Vstm2a A T 11: 16,211,483 (GRCm39) I98F probably benign Het
Zdhhc13 T A 7: 48,466,175 (GRCm39) V284D probably benign Het
Zfp668 C A 7: 127,466,203 (GRCm39) R327L probably damaging Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Ugt2b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Ugt2b36 APN 5 87,229,440 (GRCm39) missense possibly damaging 0.73
IGL01024:Ugt2b36 APN 5 87,228,728 (GRCm39) critical splice donor site probably null
IGL01295:Ugt2b36 APN 5 87,228,744 (GRCm39) missense probably damaging 1.00
IGL01331:Ugt2b36 APN 5 87,238,801 (GRCm39) missense probably damaging 1.00
IGL02597:Ugt2b36 APN 5 87,228,783 (GRCm39) missense probably damaging 1.00
IGL02967:Ugt2b36 APN 5 87,238,759 (GRCm39) missense possibly damaging 0.48
IGL03053:Ugt2b36 APN 5 87,239,933 (GRCm39) missense possibly damaging 0.95
R0370:Ugt2b36 UTSW 5 87,239,834 (GRCm39) missense probably benign 0.04
R0616:Ugt2b36 UTSW 5 87,237,336 (GRCm39) missense probably benign 0.01
R0827:Ugt2b36 UTSW 5 87,214,234 (GRCm39) missense possibly damaging 0.83
R0885:Ugt2b36 UTSW 5 87,239,848 (GRCm39) missense probably benign 0.03
R1471:Ugt2b36 UTSW 5 87,239,930 (GRCm39) missense probably damaging 1.00
R1567:Ugt2b36 UTSW 5 87,240,258 (GRCm39) missense probably damaging 1.00
R1782:Ugt2b36 UTSW 5 87,229,440 (GRCm39) missense possibly damaging 0.73
R1974:Ugt2b36 UTSW 5 87,228,727 (GRCm39) critical splice donor site probably null
R2065:Ugt2b36 UTSW 5 87,240,100 (GRCm39) missense probably benign 0.03
R2068:Ugt2b36 UTSW 5 87,240,100 (GRCm39) missense probably benign 0.03
R2111:Ugt2b36 UTSW 5 87,240,100 (GRCm39) missense probably benign 0.03
R2272:Ugt2b36 UTSW 5 87,214,114 (GRCm39) missense possibly damaging 0.65
R2696:Ugt2b36 UTSW 5 87,237,344 (GRCm39) missense probably damaging 1.00
R4626:Ugt2b36 UTSW 5 87,239,947 (GRCm39) missense probably damaging 1.00
R4700:Ugt2b36 UTSW 5 87,240,301 (GRCm39) critical splice donor site probably null
R4731:Ugt2b36 UTSW 5 87,229,397 (GRCm39) nonsense probably null
R4732:Ugt2b36 UTSW 5 87,229,397 (GRCm39) nonsense probably null
R4733:Ugt2b36 UTSW 5 87,229,397 (GRCm39) nonsense probably null
R4922:Ugt2b36 UTSW 5 87,214,183 (GRCm39) missense probably damaging 1.00
R5217:Ugt2b36 UTSW 5 87,214,114 (GRCm39) missense probably damaging 0.97
R5244:Ugt2b36 UTSW 5 87,239,765 (GRCm39) missense probably damaging 0.99
R5341:Ugt2b36 UTSW 5 87,240,087 (GRCm39) nonsense probably null
R5478:Ugt2b36 UTSW 5 87,237,341 (GRCm39) missense probably damaging 1.00
R5572:Ugt2b36 UTSW 5 87,237,341 (GRCm39) missense possibly damaging 0.89
R5722:Ugt2b36 UTSW 5 87,240,297 (GRCm39) nonsense probably null
R5961:Ugt2b36 UTSW 5 87,228,724 (GRCm39) splice site probably null
R6034:Ugt2b36 UTSW 5 87,229,377 (GRCm39) missense probably damaging 1.00
R6034:Ugt2b36 UTSW 5 87,229,377 (GRCm39) missense probably damaging 1.00
R6139:Ugt2b36 UTSW 5 87,240,030 (GRCm39) missense probably benign
R6145:Ugt2b36 UTSW 5 87,214,072 (GRCm39) missense probably benign
R6226:Ugt2b36 UTSW 5 87,239,989 (GRCm39) missense probably damaging 0.99
R6531:Ugt2b36 UTSW 5 87,229,445 (GRCm39) missense probably damaging 1.00
R6704:Ugt2b36 UTSW 5 87,239,990 (GRCm39) missense probably damaging 1.00
R6895:Ugt2b36 UTSW 5 87,240,157 (GRCm39) missense probably benign 0.06
R7218:Ugt2b36 UTSW 5 87,229,398 (GRCm39) missense probably damaging 1.00
R7258:Ugt2b36 UTSW 5 87,228,762 (GRCm39) missense probably damaging 1.00
R7310:Ugt2b36 UTSW 5 87,214,138 (GRCm39) missense possibly damaging 0.94
R7650:Ugt2b36 UTSW 5 87,228,831 (GRCm39) missense probably damaging 1.00
R7707:Ugt2b36 UTSW 5 87,229,367 (GRCm39) critical splice donor site probably null
R7866:Ugt2b36 UTSW 5 87,240,190 (GRCm39) missense probably damaging 1.00
R7967:Ugt2b36 UTSW 5 87,214,236 (GRCm39) missense probably damaging 1.00
R7985:Ugt2b36 UTSW 5 87,239,983 (GRCm39) missense probably damaging 1.00
R8098:Ugt2b36 UTSW 5 87,240,252 (GRCm39) missense probably benign 0.02
R8123:Ugt2b36 UTSW 5 87,240,295 (GRCm39) missense probably damaging 1.00
R9294:Ugt2b36 UTSW 5 87,228,876 (GRCm39) missense probably damaging 1.00
R9577:Ugt2b36 UTSW 5 87,228,784 (GRCm39) missense probably benign 0.09
R9630:Ugt2b36 UTSW 5 87,239,773 (GRCm39) missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTTGGAGCAGTTCAGCTATGAG -3'
(R):5'- GGTGGACTACAGTCACTGGATG -3'

Sequencing Primer
(F):5'- CACAGGGACCAATAGCATCTG -3'
(R):5'- GGCCATGAAGTCACTGTT -3'
Posted On 2014-09-17