Mutagenetix > Incidental Mutation

Incidental Mutation 'R2066:Cntn6'

226676

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

040071-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R2066 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 104861822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 946 (R946*)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably null
Transcript: ENSMUST00000089215
AA Change: R946*

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: R946*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000161070
AA Change: R874*

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: R874*

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000162872
AA Change: R946*

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: R946*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Acadl	C	T	1: 66,841,746		probably null	Het
Acss1	G	A	2: 150,668,131	Q23*	probably null	Het
Afap1l1	A	T	18: 61,739,122		probably null	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano5	T	G	7: 51,585,386	L639R	probably damaging	Het
Arhgap26	T	C	18: 39,306,728	S71P	probably damaging	Het
B3gnt2	A	G	11: 22,836,735	L151P	probably damaging	Het
Bach1	A	T	16: 87,729,625	K658N	probably damaging	Het
Bdnf	C	A	2: 109,723,902	T207K	probably damaging	Het
Bod1l	G	T	5: 41,805,156	T2746K	probably damaging	Het
Brwd1	A	G	16: 96,046,465	S652P	probably benign	Het
Ccnt1	A	T	15: 98,551,942	H156Q	probably benign	Het
Clasp2	T	A	9: 113,906,157	I1021N	possibly damaging	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Dnaaf3	T	C	7: 4,523,799	I426M	possibly damaging	Het
Dnajc13	A	T	9: 104,221,441	I471N	probably benign	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Emx2	A	G	19: 59,461,698	N149S	probably benign	Het
Fbln7	G	T	2: 128,877,466	R61L	probably damaging	Het
Fgb	C	A	3: 83,049,689	D25Y	probably benign	Het
Filip1	A	G	9: 79,820,216	S374P	probably damaging	Het
Fry	T	A	5: 150,370,119		probably benign	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Hdlbp	A	G	1: 93,421,880		probably benign	Het
Hunk	G	A	16: 90,481,245		probably null	Het
Ifnb1	T	A	4: 88,522,759	I6F	possibly damaging	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Ints1	A	G	5: 139,767,496	V720A	probably benign	Het
Invs	T	A	4: 48,396,287	L320Q	probably damaging	Het
Jpt2	G	A	17: 24,948,739	Q79*	probably null	Het
Lingo2	A	G	4: 35,709,179	L267P	probably benign	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Meiob	G	T	17: 24,818,316	R56L	probably damaging	Het
Mindy3	A	T	2: 12,419,249	S2T	probably damaging	Het
Mrm3	A	T	11: 76,250,321	D385V	probably damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Nbea	A	G	3: 55,968,146	V1701A	probably damaging	Het
Nipal4	T	G	11: 46,156,795	D104A	probably damaging	Het
Npas4	A	G	19: 4,987,414	V284A	probably damaging	Het
Nup133	C	A	8: 123,914,575	D869Y	probably damaging	Het
Obscn	G	A	11: 59,135,732	A215V	possibly damaging	Het
Olfr1218	A	G	2: 89,054,899	Y176H	probably damaging	Het
Olfr870	G	T	9: 20,171,554	Q6K	probably benign	Het
Olfr938	T	C	9: 39,078,214	Y177C	probably damaging	Het
Pgs1	G	A	11: 118,014,570		probably benign	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Phldb2	A	T	16: 45,770,758	L970Q	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppip5k1	A	G	2: 121,342,871		probably benign	Het
Prune2	A	G	19: 17,120,678	D1182G	possibly damaging	Het
Psg25	G	A	7: 18,529,562	T112I	probably damaging	Het
Sec61g	T	C	11: 16,508,124	T24A	probably benign	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Sorbs1	T	C	19: 40,365,028		probably null	Het
Sox2	C	A	3: 34,651,307	Q298K	possibly damaging	Het
Spatc1	T	A	15: 76,283,537		probably null	Het
Szt2	T	C	4: 118,373,980	M2529V	unknown	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Tpp2	T	G	1: 43,978,438	I734S	possibly damaging	Het
Troap	T	C	15: 99,082,463	L508P	probably benign	Het
Ttc28	C	A	5: 111,225,933	F1078L	probably benign	Het
Ttn	T	C	2: 76,714,373	N32795S	probably damaging	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Ugt2b36	T	C	5: 87,092,241	E95G	probably benign	Het
Vmn1r55	A	G	7: 5,147,049	V125A	possibly damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Zdhhc13	T	A	7: 48,816,427	V284D	probably benign	Het
Zfp668	C	A	7: 127,867,031	R327L	probably damaging	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATAAGCCAACCTGAATGTTTGC -3'
(R):5'- AAAGTCCCTGGGAACATTTGTG -3'

Sequencing Primer
(F):5'- CCAACCTGAATGTTTGCATGTAAGG -3'
(R):5'- AACATTTGTGCTGCAGGTGCC -3'

Posted On

2014-09-17