Incidental Mutation 'R2066:Cntn6'
ID 226676
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission 040071-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R2066 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 104492790-104863406 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 104861822 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 946 (R946*)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably null
Transcript: ENSMUST00000089215
AA Change: R946*
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: R946*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161070
AA Change: R874*
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: R874*

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162872
AA Change: R946*
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: R946*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bdnf C A 2: 109,723,902 T207K probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 S652P probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phldb2 A T 16: 45,770,758 L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 I734S possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
R8463:Cntn6 UTSW 6 104772619 missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104848132 missense probably benign 0.05
R9232:Cntn6 UTSW 6 104838820 missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104832510 missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104804347 missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104833083 nonsense probably null
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGCCAACCTGAATGTTTGC -3'
(R):5'- AAAGTCCCTGGGAACATTTGTG -3'

Sequencing Primer
(F):5'- CCAACCTGAATGTTTGCATGTAAGG -3'
(R):5'- AACATTTGTGCTGCAGGTGCC -3'
Posted On 2014-09-17