Incidental Mutation 'R2066:Nup133'
ID 226686
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Name nucleoporin 133
Synonyms mermaid, 4832420O05Rik
MMRRC Submission 040071-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2066 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123897123-123949265 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 123914575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 869 (D869Y)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
AlphaFold Q8R0G9
Predicted Effect probably damaging
Transcript: ENSMUST00000044795
AA Change: D869Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: D869Y

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213089
Meta Mutation Damage Score 0.5513 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 (GRCm38) I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 (GRCm38) probably benign Het
Acadl C T 1: 66,841,746 (GRCm38) probably null Het
Acss1 G A 2: 150,668,131 (GRCm38) Q23* probably null Het
Afap1l1 A T 18: 61,739,122 (GRCm38) probably null Het
Akt3 A G 1: 177,102,985 (GRCm38) S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 (GRCm38) I108V probably benign Het
Ano5 T G 7: 51,585,386 (GRCm38) L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 (GRCm38) S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 (GRCm38) L151P probably damaging Het
Bach1 A T 16: 87,729,625 (GRCm38) K658N probably damaging Het
Bdnf C A 2: 109,723,902 (GRCm38) T207K probably damaging Het
Bod1l G T 5: 41,805,156 (GRCm38) T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 (GRCm38) S652P probably benign Het
Ccnt1 A T 15: 98,551,942 (GRCm38) H156Q probably benign Het
Clasp2 T A 9: 113,906,157 (GRCm38) I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 (GRCm38) probably benign Het
Cntn6 C T 6: 104,861,822 (GRCm38) R946* probably null Het
Dnaaf3 T C 7: 4,523,799 (GRCm38) I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 (GRCm38) I471N probably benign Het
Ehd1 T C 19: 6,298,078 (GRCm38) L362P probably benign Het
Emx2 A G 19: 59,461,698 (GRCm38) N149S probably benign Het
Fbln7 G T 2: 128,877,466 (GRCm38) R61L probably damaging Het
Fgb C A 3: 83,049,689 (GRCm38) D25Y probably benign Het
Filip1 A G 9: 79,820,216 (GRCm38) S374P probably damaging Het
Fry T A 5: 150,370,119 (GRCm38) probably benign Het
Gm12695 T C 4: 96,769,726 (GRCm38) T69A probably benign Het
Gm2959 A G 14: 42,413,701 (GRCm38) noncoding transcript Het
Gm9912 T C 3: 149,185,159 (GRCm38) T113A unknown Het
Hdlbp A G 1: 93,421,880 (GRCm38) probably benign Het
Hunk G A 16: 90,481,245 (GRCm38) probably null Het
Ifnb1 T A 4: 88,522,759 (GRCm38) I6F possibly damaging Het
Il2rg A G X: 101,267,810 (GRCm38) L57P possibly damaging Het
Ints1 A G 5: 139,767,496 (GRCm38) V720A probably benign Het
Invs T A 4: 48,396,287 (GRCm38) L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 (GRCm38) Q79* probably null Het
Lingo2 A G 4: 35,709,179 (GRCm38) L267P probably benign Het
Lonp2 A G 8: 86,665,775 (GRCm38) T490A probably damaging Het
Meiob G T 17: 24,818,316 (GRCm38) R56L probably damaging Het
Mindy3 A T 2: 12,419,249 (GRCm38) S2T probably damaging Het
Mrm3 A T 11: 76,250,321 (GRCm38) D385V probably damaging Het
Mrto4 T C 4: 139,349,023 (GRCm38) K86E probably benign Het
Naf1 A G 8: 66,887,780 (GRCm38) D414G probably damaging Het
Nav1 C T 1: 135,449,004 (GRCm38) R1694Q probably damaging Het
Nbea A G 3: 55,968,146 (GRCm38) V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 (GRCm38) D104A probably damaging Het
Npas4 A G 19: 4,987,414 (GRCm38) V284A probably damaging Het
Obscn G A 11: 59,135,732 (GRCm38) A215V possibly damaging Het
Or4c113 A G 2: 89,054,899 (GRCm38) Y176H probably damaging Het
Or8b12i G T 9: 20,171,554 (GRCm38) Q6K probably benign Het
Or8g24 T C 9: 39,078,214 (GRCm38) Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 (GRCm38) probably benign Het
Phc2 T C 4: 128,747,136 (GRCm38) F672S probably damaging Het
Phldb2 A T 16: 45,770,758 (GRCm38) L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 (GRCm38) Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 (GRCm38) probably benign Het
Prune2 A G 19: 17,120,678 (GRCm38) D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 (GRCm38) T112I probably damaging Het
Sec61g T C 11: 16,508,124 (GRCm38) T24A probably benign Het
Skint1 T A 4: 112,025,533 (GRCm38) V258D probably benign Het
Sorbs1 T C 19: 40,365,028 (GRCm38) probably null Het
Sox2 C A 3: 34,651,307 (GRCm38) Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 (GRCm38) probably null Het
Szt2 T C 4: 118,373,980 (GRCm38) M2529V unknown Het
Thrap3 T C 4: 126,175,396 (GRCm38) Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 (GRCm38) I734S possibly damaging Het
Troap T C 15: 99,082,463 (GRCm38) L508P probably benign Het
Ttc28 C A 5: 111,225,933 (GRCm38) F1078L probably benign Het
Ttn T C 2: 76,714,373 (GRCm38) N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 (GRCm38) A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 (GRCm38) E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 (GRCm38) V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 (GRCm38) I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 (GRCm38) V284D probably benign Het
Zfp668 C A 7: 127,867,031 (GRCm38) R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 (GRCm38) C1589R probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123,939,083 (GRCm38) missense probably damaging 0.98
IGL00507:Nup133 APN 8 123,918,967 (GRCm38) nonsense probably null
IGL00585:Nup133 APN 8 123,909,994 (GRCm38) missense probably damaging 1.00
IGL00676:Nup133 APN 8 123,906,298 (GRCm38) intron probably benign
IGL00966:Nup133 APN 8 123,911,906 (GRCm38) missense probably damaging 0.98
IGL01069:Nup133 APN 8 123,930,982 (GRCm38) nonsense probably null
IGL01553:Nup133 APN 8 123,915,324 (GRCm38) missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123,939,130 (GRCm38) nonsense probably null
IGL01730:Nup133 APN 8 123,938,233 (GRCm38) missense probably benign 0.00
IGL01996:Nup133 APN 8 123,946,595 (GRCm38) missense probably benign 0.00
IGL02332:Nup133 APN 8 123,907,832 (GRCm38) missense probably damaging 1.00
IGL02552:Nup133 APN 8 123,929,255 (GRCm38) missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123,949,083 (GRCm38) missense probably benign 0.00
IGL03009:Nup133 APN 8 123,933,500 (GRCm38) missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123,946,594 (GRCm38) missense probably benign 0.11
Cadenza UTSW 8 123,911,888 (GRCm38) frame shift probably null
Gangen UTSW 8 123,916,282 (GRCm38) critical splice donor site probably null
hochzeit UTSW 8 123,929,343 (GRCm38) missense probably benign 0.00
low_road UTSW 8 123,904,579 (GRCm38) missense probably damaging 1.00
Pathway UTSW 8 123,917,446 (GRCm38) missense possibly damaging 0.82
Slant UTSW 8 123,916,281 (GRCm38) splice site probably null
R0010:Nup133 UTSW 8 123,904,579 (GRCm38) missense probably damaging 1.00
R0010:Nup133 UTSW 8 123,904,579 (GRCm38) missense probably damaging 1.00
R0139:Nup133 UTSW 8 123,929,343 (GRCm38) missense probably benign 0.00
R0344:Nup133 UTSW 8 123,917,446 (GRCm38) missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123,949,008 (GRCm38) missense probably benign 0.00
R1301:Nup133 UTSW 8 123,917,417 (GRCm38) intron probably benign
R1453:Nup133 UTSW 8 123,915,375 (GRCm38) missense probably benign 0.00
R1570:Nup133 UTSW 8 123,949,176 (GRCm38) start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123,949,035 (GRCm38) missense probably benign 0.02
R1773:Nup133 UTSW 8 123,930,983 (GRCm38) nonsense probably null
R1992:Nup133 UTSW 8 123,906,221 (GRCm38) missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123,914,575 (GRCm38) missense probably damaging 1.00
R2065:Nup133 UTSW 8 123,914,575 (GRCm38) missense probably damaging 1.00
R2068:Nup133 UTSW 8 123,914,575 (GRCm38) missense probably damaging 1.00
R4397:Nup133 UTSW 8 123,944,301 (GRCm38) missense probably benign 0.04
R4683:Nup133 UTSW 8 123,930,982 (GRCm38) nonsense probably null
R4771:Nup133 UTSW 8 123,929,398 (GRCm38) missense probably damaging 1.00
R4910:Nup133 UTSW 8 123,927,131 (GRCm38) missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123,927,131 (GRCm38) missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123,915,196 (GRCm38) missense probably benign 0.07
R5411:Nup133 UTSW 8 123,927,206 (GRCm38) missense probably benign
R5470:Nup133 UTSW 8 123,930,966 (GRCm38) missense probably benign 0.00
R5664:Nup133 UTSW 8 123,906,281 (GRCm38) missense probably benign 0.01
R5907:Nup133 UTSW 8 123,916,299 (GRCm38) missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123,938,292 (GRCm38) missense probably damaging 0.98
R6059:Nup133 UTSW 8 123,914,596 (GRCm38) missense probably damaging 1.00
R6219:Nup133 UTSW 8 123,936,873 (GRCm38) missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123,917,437 (GRCm38) missense probably benign 0.01
R6672:Nup133 UTSW 8 123,916,281 (GRCm38) splice site probably null
R6737:Nup133 UTSW 8 123,906,291 (GRCm38) missense probably damaging 0.99
R6763:Nup133 UTSW 8 123,944,278 (GRCm38) missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123,899,507 (GRCm38) missense probably benign 0.08
R6975:Nup133 UTSW 8 123,915,318 (GRCm38) missense probably damaging 0.99
R7101:Nup133 UTSW 8 123,906,227 (GRCm38) missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123,915,373 (GRCm38) missense probably benign 0.00
R7271:Nup133 UTSW 8 123,922,414 (GRCm38) missense probably benign 0.34
R7501:Nup133 UTSW 8 123,922,414 (GRCm38) missense probably benign 0.34
R8054:Nup133 UTSW 8 123,949,217 (GRCm38) intron probably benign
R8397:Nup133 UTSW 8 123,922,417 (GRCm38) missense probably benign 0.17
R8703:Nup133 UTSW 8 123,916,282 (GRCm38) critical splice donor site probably null
R8811:Nup133 UTSW 8 123,911,888 (GRCm38) frame shift probably null
R8813:Nup133 UTSW 8 123,911,888 (GRCm38) frame shift probably null
R8952:Nup133 UTSW 8 123,907,761 (GRCm38) missense probably damaging 1.00
R9116:Nup133 UTSW 8 123,933,416 (GRCm38) missense probably benign 0.00
R9340:Nup133 UTSW 8 123,938,142 (GRCm38) missense probably benign 0.38
X0023:Nup133 UTSW 8 123,909,988 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCAACAAGACAATGTAATGTG -3'
(R):5'- AGTAGTGGGAGTCTCCTCTG -3'

Sequencing Primer
(F):5'- ATGTGAAAATCTGTCATGTTCCCC -3'
(R):5'- TCTGGGGAGCCAGCAATG -3'
Posted On 2014-09-17