Mutagenetix > Incidental Mutation

Incidental Mutation 'R2066:Filip1'

226689

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

040071-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.422) question?

Stock #

R2066 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79820216 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 374 (S374P)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: S374P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: S374P

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172740

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Meta Mutation Damage Score

0.1223

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Acadl	C	T	1: 66,841,746		probably null	Het
Acss1	G	A	2: 150,668,131	Q23*	probably null	Het
Afap1l1	A	T	18: 61,739,122		probably null	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano5	T	G	7: 51,585,386	L639R	probably damaging	Het
Arhgap26	T	C	18: 39,306,728	S71P	probably damaging	Het
B3gnt2	A	G	11: 22,836,735	L151P	probably damaging	Het
Bach1	A	T	16: 87,729,625	K658N	probably damaging	Het
Bdnf	C	A	2: 109,723,902	T207K	probably damaging	Het
Bod1l	G	T	5: 41,805,156	T2746K	probably damaging	Het
Brwd1	A	G	16: 96,046,465	S652P	probably benign	Het
Ccnt1	A	T	15: 98,551,942	H156Q	probably benign	Het
Clasp2	T	A	9: 113,906,157	I1021N	possibly damaging	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Cntn6	C	T	6: 104,861,822	R946*	probably null	Het
Dnaaf3	T	C	7: 4,523,799	I426M	possibly damaging	Het
Dnajc13	A	T	9: 104,221,441	I471N	probably benign	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Emx2	A	G	19: 59,461,698	N149S	probably benign	Het
Fbln7	G	T	2: 128,877,466	R61L	probably damaging	Het
Fgb	C	A	3: 83,049,689	D25Y	probably benign	Het
Fry	T	A	5: 150,370,119		probably benign	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Hdlbp	A	G	1: 93,421,880		probably benign	Het
Hunk	G	A	16: 90,481,245		probably null	Het
Ifnb1	T	A	4: 88,522,759	I6F	possibly damaging	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Ints1	A	G	5: 139,767,496	V720A	probably benign	Het
Invs	T	A	4: 48,396,287	L320Q	probably damaging	Het
Jpt2	G	A	17: 24,948,739	Q79*	probably null	Het
Lingo2	A	G	4: 35,709,179	L267P	probably benign	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Meiob	G	T	17: 24,818,316	R56L	probably damaging	Het
Mindy3	A	T	2: 12,419,249	S2T	probably damaging	Het
Mrm3	A	T	11: 76,250,321	D385V	probably damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Nbea	A	G	3: 55,968,146	V1701A	probably damaging	Het
Nipal4	T	G	11: 46,156,795	D104A	probably damaging	Het
Npas4	A	G	19: 4,987,414	V284A	probably damaging	Het
Nup133	C	A	8: 123,914,575	D869Y	probably damaging	Het
Obscn	G	A	11: 59,135,732	A215V	possibly damaging	Het
Olfr1218	A	G	2: 89,054,899	Y176H	probably damaging	Het
Olfr870	G	T	9: 20,171,554	Q6K	probably benign	Het
Olfr938	T	C	9: 39,078,214	Y177C	probably damaging	Het
Pgs1	G	A	11: 118,014,570		probably benign	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Phldb2	A	T	16: 45,770,758	L970Q	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppip5k1	A	G	2: 121,342,871		probably benign	Het
Prune2	A	G	19: 17,120,678	D1182G	possibly damaging	Het
Psg25	G	A	7: 18,529,562	T112I	probably damaging	Het
Sec61g	T	C	11: 16,508,124	T24A	probably benign	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Sorbs1	T	C	19: 40,365,028		probably null	Het
Sox2	C	A	3: 34,651,307	Q298K	possibly damaging	Het
Spatc1	T	A	15: 76,283,537		probably null	Het
Szt2	T	C	4: 118,373,980	M2529V	unknown	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Tpp2	T	G	1: 43,978,438	I734S	possibly damaging	Het
Troap	T	C	15: 99,082,463	L508P	probably benign	Het
Ttc28	C	A	5: 111,225,933	F1078L	probably benign	Het
Ttn	T	C	2: 76,714,373	N32795S	probably damaging	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Ugt2b36	T	C	5: 87,092,241	E95G	probably benign	Het
Vmn1r55	A	G	7: 5,147,049	V125A	possibly damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Zdhhc13	T	A	7: 48,816,427	V284D	probably benign	Het
Zfp668	C	A	7: 127,867,031	R327L	probably damaging	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCTTCTCCAGTTCAGACATCC -3'
(R):5'- ACAAGGCCTCGAGGTTTTCC -3'

Sequencing Primer
(F):5'- AGTTCAGACATCCTCTTCTGCAG -3'
(R):5'- TTTTCCCAGGAGCACGAAG -3'

Posted On

2014-09-17