Mutagenetix > Incidental Mutations

Incidental Mutation 'R2066:Dnajc13'

226690

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

040071-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R2066 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104221441 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 471 (I471N)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: I471N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: I471N

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: I471N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: I471N

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Meta Mutation Damage Score

0.0867

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Acadl	C	T	1: 66,841,746		probably null	Het
Acss1	G	A	2: 150,668,131	Q23*	probably null	Het
Afap1l1	A	T	18: 61,739,122		probably null	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano5	T	G	7: 51,585,386	L639R	probably damaging	Het
Arhgap26	T	C	18: 39,306,728	S71P	probably damaging	Het
B3gnt2	A	G	11: 22,836,735	L151P	probably damaging	Het
Bach1	A	T	16: 87,729,625	K658N	probably damaging	Het
Bdnf	C	A	2: 109,723,902	T207K	probably damaging	Het
Bod1l	G	T	5: 41,805,156	T2746K	probably damaging	Het
Brwd1	A	G	16: 96,046,465	S652P	probably benign	Het
Ccnt1	A	T	15: 98,551,942	H156Q	probably benign	Het
Clasp2	T	A	9: 113,906,157	I1021N	possibly damaging	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Cntn6	C	T	6: 104,861,822	R946*	probably null	Het
Dnaaf3	T	C	7: 4,523,799	I426M	possibly damaging	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Emx2	A	G	19: 59,461,698	N149S	probably benign	Het
Fbln7	G	T	2: 128,877,466	R61L	probably damaging	Het
Fgb	C	A	3: 83,049,689	D25Y	probably benign	Het
Filip1	A	G	9: 79,820,216	S374P	probably damaging	Het
Fry	T	A	5: 150,370,119		probably benign	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Hdlbp	A	G	1: 93,421,880		probably benign	Het
Hunk	G	A	16: 90,481,245		probably null	Het
Ifnb1	T	A	4: 88,522,759	I6F	possibly damaging	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Ints1	A	G	5: 139,767,496	V720A	probably benign	Het
Invs	T	A	4: 48,396,287	L320Q	probably damaging	Het
Jpt2	G	A	17: 24,948,739	Q79*	probably null	Het
Lingo2	A	G	4: 35,709,179	L267P	probably benign	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Meiob	G	T	17: 24,818,316	R56L	probably damaging	Het
Mindy3	A	T	2: 12,419,249	S2T	probably damaging	Het
Mrm3	A	T	11: 76,250,321	D385V	probably damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Nbea	A	G	3: 55,968,146	V1701A	probably damaging	Het
Nipal4	T	G	11: 46,156,795	D104A	probably damaging	Het
Npas4	A	G	19: 4,987,414	V284A	probably damaging	Het
Nup133	C	A	8: 123,914,575	D869Y	probably damaging	Het
Obscn	G	A	11: 59,135,732	A215V	possibly damaging	Het
Olfr1218	A	G	2: 89,054,899	Y176H	probably damaging	Het
Olfr870	G	T	9: 20,171,554	Q6K	probably benign	Het
Olfr938	T	C	9: 39,078,214	Y177C	probably damaging	Het
Pgs1	G	A	11: 118,014,570		probably benign	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Phldb2	A	T	16: 45,770,758	L970Q	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppip5k1	A	G	2: 121,342,871		probably benign	Het
Prune2	A	G	19: 17,120,678	D1182G	possibly damaging	Het
Psg25	G	A	7: 18,529,562	T112I	probably damaging	Het
Sec61g	T	C	11: 16,508,124	T24A	probably benign	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Sorbs1	T	C	19: 40,365,028		probably null	Het
Sox2	C	A	3: 34,651,307	Q298K	possibly damaging	Het
Spatc1	T	A	15: 76,283,537		probably null	Het
Szt2	T	C	4: 118,373,980	M2529V	unknown	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Tpp2	T	G	1: 43,978,438	I734S	possibly damaging	Het
Troap	T	C	15: 99,082,463	L508P	probably benign	Het
Ttc28	C	A	5: 111,225,933	F1078L	probably benign	Het
Ttn	T	C	2: 76,714,373	N32795S	probably damaging	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Ugt2b36	T	C	5: 87,092,241	E95G	probably benign	Het
Vmn1r55	A	G	7: 5,147,049	V125A	possibly damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Zdhhc13	T	A	7: 48,816,427	V284D	probably benign	Het
Zfp668	C	A	7: 127,867,031	R327L	probably damaging	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTGAGACTACCTGCCAAC -3'
(R):5'- AAGTGCATTCCAGAGGTGGG -3'

Sequencing Primer
(F):5'- GTGAGACTACCTGCCAACAGTTTG -3'
(R):5'- GGGATTTTGAGCATGTAACTGATACC -3'

Posted On

2014-09-17