Incidental Mutation 'R2066:Nipal4'
ID 226696
Institutional Source Beutler Lab
Gene Symbol Nipal4
Ensembl Gene ENSMUSG00000020411
Gene Name NIPA-like domain containing 4
Synonyms 9530066K23Rik
MMRRC Submission 040071-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R2066 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 46038982-46057186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46047622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 104 (D104A)
Ref Sequence ENSEMBL: ENSMUSP00000020679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020679]
AlphaFold Q8BZF2
Predicted Effect probably damaging
Transcript: ENSMUST00000020679
AA Change: D104A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020679
Gene: ENSMUSG00000020411
AA Change: D104A

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 56 350 1.6e-122 PFAM
Meta Mutation Damage Score 0.5061 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a membrane receptor. Mutations in this gene have been associated with autosomal recessive congenital ichthyosis. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Acadl C T 1: 66,880,905 (GRCm39) probably null Het
Acss1 G A 2: 150,510,051 (GRCm39) Q23* probably null Het
Afap1l1 A T 18: 61,872,193 (GRCm39) probably null Het
Akt3 A G 1: 176,930,551 (GRCm39) S136P possibly damaging Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ano5 T G 7: 51,235,134 (GRCm39) L639R probably damaging Het
Arhgap26 T C 18: 39,439,781 (GRCm39) S71P probably damaging Het
B3gnt2 A G 11: 22,786,735 (GRCm39) L151P probably damaging Het
Bach1 A T 16: 87,526,513 (GRCm39) K658N probably damaging Het
Bdnf C A 2: 109,554,247 (GRCm39) T207K probably damaging Het
Bod1l G T 5: 41,962,499 (GRCm39) T2746K probably damaging Het
Brwd1 A G 16: 95,847,665 (GRCm39) S652P probably benign Het
Ccnt1 A T 15: 98,449,823 (GRCm39) H156Q probably benign Het
Clasp2 T A 9: 113,735,225 (GRCm39) I1021N possibly damaging Het
Cnep1r1 G T 8: 88,845,445 (GRCm39) probably benign Het
Cntn6 C T 6: 104,838,783 (GRCm39) R946* probably null Het
Dnaaf3 T C 7: 4,526,798 (GRCm39) I426M possibly damaging Het
Dnajc13 A T 9: 104,098,640 (GRCm39) I471N probably benign Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Emx2 A G 19: 59,450,130 (GRCm39) N149S probably benign Het
Fbln7 G T 2: 128,719,386 (GRCm39) R61L probably damaging Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Filip1 A G 9: 79,727,498 (GRCm39) S374P probably damaging Het
Fry T A 5: 150,293,584 (GRCm39) probably benign Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm2959 A G 14: 42,235,658 (GRCm39) noncoding transcript Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Hdlbp A G 1: 93,349,602 (GRCm39) probably benign Het
Hunk G A 16: 90,278,133 (GRCm39) probably null Het
Ifnb1 T A 4: 88,440,996 (GRCm39) I6F possibly damaging Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Ints1 A G 5: 139,753,251 (GRCm39) V720A probably benign Het
Invs T A 4: 48,396,287 (GRCm39) L320Q probably damaging Het
Jpt2 G A 17: 25,167,713 (GRCm39) Q79* probably null Het
Lingo2 A G 4: 35,709,179 (GRCm39) L267P probably benign Het
Lonp2 A G 8: 87,392,403 (GRCm39) T490A probably damaging Het
Meiob G T 17: 25,037,290 (GRCm39) R56L probably damaging Het
Mindy3 A T 2: 12,424,060 (GRCm39) S2T probably damaging Het
Mrm3 A T 11: 76,141,147 (GRCm39) D385V probably damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Naf1 A G 8: 67,340,432 (GRCm39) D414G probably damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Nbea A G 3: 55,875,567 (GRCm39) V1701A probably damaging Het
Npas4 A G 19: 5,037,442 (GRCm39) V284A probably damaging Het
Nup133 C A 8: 124,641,314 (GRCm39) D869Y probably damaging Het
Obscn G A 11: 59,026,558 (GRCm39) A215V possibly damaging Het
Or4c113 A G 2: 88,885,243 (GRCm39) Y176H probably damaging Het
Or8b12i G T 9: 20,082,850 (GRCm39) Q6K probably benign Het
Or8g24 T C 9: 38,989,510 (GRCm39) Y177C probably damaging Het
Pgs1 G A 11: 117,905,396 (GRCm39) probably benign Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Phldb2 A T 16: 45,591,121 (GRCm39) L970Q probably damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Ppip5k1 A G 2: 121,173,352 (GRCm39) probably benign Het
Prune2 A G 19: 17,098,042 (GRCm39) D1182G possibly damaging Het
Psg25 G A 7: 18,263,487 (GRCm39) T112I probably damaging Het
Sec61g T C 11: 16,458,124 (GRCm39) T24A probably benign Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Sorbs1 T C 19: 40,353,472 (GRCm39) probably null Het
Sox2 C A 3: 34,705,456 (GRCm39) Q298K possibly damaging Het
Spatc1 T A 15: 76,167,737 (GRCm39) probably null Het
Szt2 T C 4: 118,231,177 (GRCm39) M2529V unknown Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Tpp2 T G 1: 44,017,598 (GRCm39) I734S possibly damaging Het
Troap T C 15: 98,980,344 (GRCm39) L508P probably benign Het
Ttc28 C A 5: 111,373,799 (GRCm39) F1078L probably benign Het
Ttn T C 2: 76,544,717 (GRCm39) N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Ugt2b36 T C 5: 87,240,100 (GRCm39) E95G probably benign Het
Vmn1r55 A G 7: 5,150,048 (GRCm39) V125A possibly damaging Het
Vstm2a A T 11: 16,211,483 (GRCm39) I98F probably benign Het
Zdhhc13 T A 7: 48,466,175 (GRCm39) V284D probably benign Het
Zfp668 C A 7: 127,466,203 (GRCm39) R327L probably damaging Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Nipal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Nipal4 APN 11 46,042,152 (GRCm39) missense probably damaging 1.00
IGL03203:Nipal4 APN 11 46,041,123 (GRCm39) missense probably damaging 1.00
H8786:Nipal4 UTSW 11 46,041,304 (GRCm39) missense probably damaging 1.00
R0239:Nipal4 UTSW 11 46,041,268 (GRCm39) missense possibly damaging 0.80
R0239:Nipal4 UTSW 11 46,041,268 (GRCm39) missense possibly damaging 0.80
R0331:Nipal4 UTSW 11 46,041,040 (GRCm39) missense probably damaging 1.00
R0414:Nipal4 UTSW 11 46,052,735 (GRCm39) missense probably damaging 1.00
R0613:Nipal4 UTSW 11 46,041,211 (GRCm39) missense probably benign 0.31
R0940:Nipal4 UTSW 11 46,041,139 (GRCm39) missense possibly damaging 0.48
R1797:Nipal4 UTSW 11 46,042,160 (GRCm39) missense probably benign 0.06
R1889:Nipal4 UTSW 11 46,041,560 (GRCm39) missense probably damaging 0.99
R1899:Nipal4 UTSW 11 46,041,058 (GRCm39) missense probably damaging 1.00
R1974:Nipal4 UTSW 11 46,042,210 (GRCm39) missense probably damaging 1.00
R3705:Nipal4 UTSW 11 46,052,678 (GRCm39) splice site probably benign
R3941:Nipal4 UTSW 11 46,041,473 (GRCm39) missense probably damaging 1.00
R4597:Nipal4 UTSW 11 46,042,156 (GRCm39) missense probably damaging 1.00
R4965:Nipal4 UTSW 11 46,052,837 (GRCm39) missense possibly damaging 0.68
R5888:Nipal4 UTSW 11 46,042,166 (GRCm39) missense probably damaging 0.98
R6533:Nipal4 UTSW 11 46,041,234 (GRCm39) nonsense probably null
R7444:Nipal4 UTSW 11 46,057,062 (GRCm39) missense probably benign 0.27
R8099:Nipal4 UTSW 11 46,052,848 (GRCm39) missense probably benign 0.05
R8203:Nipal4 UTSW 11 46,041,147 (GRCm39) missense probably damaging 1.00
R8825:Nipal4 UTSW 11 46,052,873 (GRCm39) missense probably benign 0.01
R8826:Nipal4 UTSW 11 46,045,470 (GRCm39) missense possibly damaging 0.63
R8881:Nipal4 UTSW 11 46,042,177 (GRCm39) missense probably benign 0.00
R9514:Nipal4 UTSW 11 46,052,922 (GRCm39) critical splice acceptor site probably null
R9768:Nipal4 UTSW 11 46,041,473 (GRCm39) missense probably damaging 1.00
X0018:Nipal4 UTSW 11 46,052,873 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGATTGCACAGAGTAAGATGTCTG -3'
(R):5'- GATGCGACAGATGCTGAGTG -3'

Sequencing Primer
(F):5'- GCAGAGGCAAGATTTTCCCAAG -3'
(R):5'- GTAGTTAGACACACAGCTGGATTC -3'
Posted On 2014-09-17