Incidental Mutation 'R2066:Phldb2'
ID226706
Institutional Source Beutler Lab
Gene Symbol Phldb2
Ensembl Gene ENSMUSG00000033149
Gene Namepleckstrin homology like domain, family B, member 2
SynonymsLL5b, LL5beta, C820004H04Rik
MMRRC Submission 040071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2066 (G1)
Quality Score195
Status Validated
Chromosome16
Chromosomal Location45746243-45953598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45770758 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 970 (L970Q)
Ref Sequence ENSEMBL: ENSMUSP00000123284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000076333] [ENSMUST00000134802]
Predicted Effect probably damaging
Transcript: ENSMUST00000036355
AA Change: L925Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149
AA Change: L925Q

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
coiled coil region 1027 1097 N/A INTRINSIC
PH 1140 1244 6.45e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076333
AA Change: L978Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149
AA Change: L978Q

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131003
AA Change: L240Q
SMART Domains Protein: ENSMUSP00000119718
Gene: ENSMUSG00000033149
AA Change: L240Q

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
coiled coil region 87 163 N/A INTRINSIC
coiled coil region 342 412 N/A INTRINSIC
PH 456 560 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133111
Predicted Effect probably damaging
Transcript: ENSMUST00000134802
AA Change: L970Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123284
Gene: ENSMUSG00000033149
AA Change: L970Q

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
coiled coil region 625 737 N/A INTRINSIC
coiled coil region 769 845 N/A INTRINSIC
coiled coil region 1072 1131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151300
Meta Mutation Damage Score 0.2491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bdnf C A 2: 109,723,902 T207K probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 S652P probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cntn6 C T 6: 104,861,822 R946* probably null Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 I734S possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Phldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Phldb2 APN 16 45772254 missense probably damaging 1.00
IGL00485:Phldb2 APN 16 45757188 missense possibly damaging 0.75
IGL00544:Phldb2 APN 16 45825311 missense probably damaging 1.00
IGL00547:Phldb2 APN 16 45825535 missense probably benign 0.00
IGL00835:Phldb2 APN 16 45751456 missense probably damaging 1.00
IGL00987:Phldb2 APN 16 45763102 missense possibly damaging 0.78
IGL01102:Phldb2 APN 16 45825060 missense probably damaging 1.00
IGL01530:Phldb2 APN 16 45802729 missense probably damaging 1.00
IGL01549:Phldb2 APN 16 45774318 missense probably benign 0.00
IGL01712:Phldb2 APN 16 45751429 missense probably damaging 1.00
IGL01755:Phldb2 APN 16 45825582 missense probably damaging 0.96
IGL01823:Phldb2 APN 16 45825144 missense probably damaging 0.97
IGL02353:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02360:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02716:Phldb2 APN 16 45801590 missense probably damaging 0.99
R0139:Phldb2 UTSW 16 45770666 splice site probably benign
R0312:Phldb2 UTSW 16 45789047 missense probably damaging 1.00
R0379:Phldb2 UTSW 16 45781451 missense probably damaging 1.00
R0535:Phldb2 UTSW 16 45757127 missense probably damaging 1.00
R1387:Phldb2 UTSW 16 45825994 missense possibly damaging 0.69
R1444:Phldb2 UTSW 16 45757253 splice site probably benign
R1487:Phldb2 UTSW 16 45789024 missense probably damaging 1.00
R1501:Phldb2 UTSW 16 45777783 missense probably damaging 1.00
R1605:Phldb2 UTSW 16 45770779 splice site probably benign
R1716:Phldb2 UTSW 16 45775050 missense probably benign 0.01
R1732:Phldb2 UTSW 16 45757166 missense probably damaging 1.00
R1779:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R1824:Phldb2 UTSW 16 45826011 missense probably benign 0.14
R2001:Phldb2 UTSW 16 45774195 missense possibly damaging 0.66
R2122:Phldb2 UTSW 16 45762941 missense probably damaging 0.99
R2448:Phldb2 UTSW 16 45825363 missense probably damaging 1.00
R2932:Phldb2 UTSW 16 45748785 missense possibly damaging 0.85
R3076:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3078:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3779:Phldb2 UTSW 16 45748755 missense probably damaging 1.00
R3914:Phldb2 UTSW 16 45757163 missense probably damaging 1.00
R4536:Phldb2 UTSW 16 45770681 missense probably benign 0.04
R4568:Phldb2 UTSW 16 45777718 nonsense probably null
R4798:Phldb2 UTSW 16 45825874 missense probably damaging 1.00
R4853:Phldb2 UTSW 16 45802716 missense probably damaging 0.99
R4906:Phldb2 UTSW 16 45751395 missense probably damaging 1.00
R4984:Phldb2 UTSW 16 45825633 missense probably damaging 1.00
R5078:Phldb2 UTSW 16 45777742 missense possibly damaging 0.85
R5137:Phldb2 UTSW 16 45808258 missense possibly damaging 0.85
R5237:Phldb2 UTSW 16 45747886 missense probably damaging 0.99
R5410:Phldb2 UTSW 16 45825612 missense possibly damaging 0.77
R5825:Phldb2 UTSW 16 45763097 missense probably benign 0.11
R5874:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R5907:Phldb2 UTSW 16 45825188 missense probably damaging 1.00
R6332:Phldb2 UTSW 16 45774246 missense probably benign
R6354:Phldb2 UTSW 16 45825114 missense probably damaging 1.00
R6355:Phldb2 UTSW 16 45825338 missense probably damaging 0.99
R6383:Phldb2 UTSW 16 45748750 missense probably damaging 1.00
R6463:Phldb2 UTSW 16 45774993 missense probably benign 0.37
R6513:Phldb2 UTSW 16 45747877 missense possibly damaging 0.96
R6593:Phldb2 UTSW 16 45825427 nonsense probably null
R6756:Phldb2 UTSW 16 45808320 missense probably benign 0.02
R6810:Phldb2 UTSW 16 45748725 critical splice donor site probably null
R6897:Phldb2 UTSW 16 45777775 missense probably damaging 1.00
R7010:Phldb2 UTSW 16 45751505 missense probably damaging 0.99
R7142:Phldb2 UTSW 16 45757176 nonsense probably null
R7149:Phldb2 UTSW 16 45751532 nonsense probably null
R7249:Phldb2 UTSW 16 45801614 missense probably damaging 1.00
R7300:Phldb2 UTSW 16 45825562 missense probably damaging 1.00
R7328:Phldb2 UTSW 16 45758209 critical splice acceptor site probably null
R7515:Phldb2 UTSW 16 45774240 missense possibly damaging 0.90
R7840:Phldb2 UTSW 16 45751364 missense probably damaging 1.00
R7923:Phldb2 UTSW 16 45751364 missense probably damaging 1.00
RF008:Phldb2 UTSW 16 45762974 missense probably damaging 1.00
Z1176:Phldb2 UTSW 16 45825826 missense probably benign 0.43
Z1176:Phldb2 UTSW 16 45825827 missense probably benign 0.04
Z1176:Phldb2 UTSW 16 45953508 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAGGACATGGGTTGATCTTCCC -3'
(R):5'- AGCAGAGCTTCTTGGGAGAG -3'

Sequencing Primer
(F):5'- ATGGGTTGATCTTCCCTCCCAAC -3'
(R):5'- CTTGGGAGAGATGGTGAGTAATTAGC -3'
Posted On2014-09-17