Incidental Mutation 'R2066:Brwd1'
ID226709
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 040071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2066 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96046465 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 652 (S652P)
Ref Sequence ENSEMBL: ENSMUSP00000117066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000131322] [ENSMUST00000153398]
Predicted Effect probably benign
Transcript: ENSMUST00000023631
AA Change: S652P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: S652P

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099502
AA Change: S652P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: S652P

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113829
AA Change: S652P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: S652P

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124370
AA Change: S375P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: S375P

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126629
Predicted Effect probably benign
Transcript: ENSMUST00000131322
AA Change: S99P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914
AA Change: S99P

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000121141
Gene: ENSMUSG00000022914
AA Change: S363P

DomainStartEndE-ValueType
WD40 23 64 3.82e1 SMART
WD40 69 108 4.27e-8 SMART
WD40 129 166 8.59e-1 SMART
WD40 169 209 1.47e-6 SMART
WD40 216 256 9.21e0 SMART
low complexity region 372 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153398
AA Change: S652P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: S652P

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bdnf C A 2: 109,723,902 T207K probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cntn6 C T 6: 104,861,822 R946* probably null Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phldb2 A T 16: 45,770,758 L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 I734S possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 unclassified probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTCTGAGGTGCATGCATCTG -3'
(R):5'- TCCTAACAGGTTAGTTCTTGGG -3'

Sequencing Primer
(F):5'- GCAATGAAGCCACATCTCT -3'
(R):5'- TGGGAACTACCTTACCACAGTG -3'
Posted On2014-09-17