Incidental Mutation 'R2066:Il2rg'
ID226721
Institutional Source Beutler Lab
Gene Symbol Il2rg
Ensembl Gene ENSMUSG00000031304
Gene Nameinterleukin 2 receptor, gamma chain
Synonymscommon cytokine receptor gamma chain, gc, gamma C receptor, common gamma chain, gamma(c), CD132, [g]c
MMRRC Submission 040071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R2066 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101264378-101268255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101267810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 57 (L57P)
Ref Sequence ENSEMBL: ENSMUSP00000033664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033664] [ENSMUST00000101358] [ENSMUST00000117736] [ENSMUST00000135038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033664
AA Change: L57P

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033664
Gene: ENSMUSG00000031304
AA Change: L57P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:IL6Ra-bind 56 151 1.1e-12 PFAM
FN3 154 235 2.44e-5 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101358
SMART Domains Protein: ENSMUSP00000098910
Gene: ENSMUSG00000090141

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117736
SMART Domains Protein: ENSMUSP00000112905
Gene: ENSMUSG00000092463

DomainStartEndE-ValueType
FN3 88 169 2.44e-5 SMART
transmembrane domain 192 214 N/A INTRINSIC
Pfam:Il2rg 262 359 1.1e-32 PFAM
low complexity region 404 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127538
Predicted Effect probably benign
Transcript: ENSMUST00000135038
SMART Domains Protein: ENSMUSP00000123318
Gene: ENSMUSG00000031304

DomainStartEndE-ValueType
FN3 44 125 2.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145074
Meta Mutation Damage Score 0.7086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is a common subunit of several interleukin receptor complexes. These receptors are comprised of alpha and beta subunits in addition to this gamma subunit. Signalling through this pathway in important in immune cell differentiation and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Males hemizygous for targeted null mutations exhibit markedly reduced numbers of T and B cells, lack NK cells and Peyer's patches, and have severely reduced numbers of gut-associated intraepithelial lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bdnf C A 2: 109,723,902 T207K probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 S652P probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cntn6 C T 6: 104,861,822 R946* probably null Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phldb2 A T 16: 45,770,758 L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 I734S possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Il2rg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Il2rg APN X 101264848 unclassified probably benign
R2062:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2063:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2064:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2065:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2068:Il2rg UTSW X 101267810 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGATTGGGTCCTCAAGCAGTC -3'
(R):5'- CTAGGACCAGAGGGAGTTGTTG -3'

Sequencing Primer
(F):5'- GGGTCCTCAAGCAGTCTCTCC -3'
(R):5'- GGCCTGCTAGTGCTCACTATAATG -3'
Posted On2014-09-17