Mutagenetix > Incidental Mutations

Incidental Mutation 'R2067:Pik3c2b'

226723

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

040072-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.255) question?

Stock #

R2067 (G1)

Quality Score

190

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133099611 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1283 (S1283P)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: S1283P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: S1283P

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Meta Mutation Damage Score

0.1663

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Abca2	A	T	2: 25,437,505	I669F	possibly damaging	Het
Acin1	T	A	14: 54,665,254	Q360H	probably damaging	Het
Aldh3b1	T	A	19: 3,921,755	D72V	probably benign	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Alpl	T	C	4: 137,749,545		probably benign	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Bod1l	G	A	5: 41,817,086	T2295M	probably benign	Het
Ccdc9	A	T	7: 16,278,550		probably null	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Csmd1	A	G	8: 15,900,782	S3476P	probably benign	Het
Ddias	A	T	7: 92,859,699	M336K	possibly damaging	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Epha1	G	T	6: 42,366,053	H187Q	probably benign	Het
Espl1	T	C	15: 102,299,090	S330P	probably damaging	Het
Fbln7	G	T	2: 128,877,466	R61L	probably damaging	Het
Fbxo41	C	T	6: 85,478,471	W577*	probably null	Het
Fgb	C	A	3: 83,049,689	D25Y	probably benign	Het
Gc	T	A	5: 89,446,517	K37N	probably damaging	Het
Gfpt1	T	C	6: 87,057,754	I178T	probably benign	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm3944	C	A	12: 18,853,894	S8*	probably null	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gpr156	A	G	16: 37,978,751	D109G	probably benign	Het
Hoxd1	A	T	2: 74,763,366	T89S	probably benign	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Itpr3	G	A	17: 27,098,076	M768I	probably benign	Het
Krt4	C	A	15: 101,924,664	A3S	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Mup4	T	A	4: 59,960,622		probably benign	Het
Myh1	G	A	11: 67,214,620	D1079N	possibly damaging	Het
Myo1a	A	G	10: 127,705,478	N43D	probably benign	Het
Napa	A	T	7: 16,115,278		probably benign	Het
Ndufa12	A	G	10: 94,220,707	D99G	probably damaging	Het
Neb	A	G	2: 52,284,263	I1528T	probably benign	Het
Nek1	T	C	8: 61,007,162	S41P	probably damaging	Het
Nolc1	C	T	19: 46,083,607	T612M	probably damaging	Het
Nsun5	T	G	5: 135,375,072	Y301D	probably damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1085	G	T	2: 86,658,437	T7K	probably damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr397	A	G	11: 73,964,914	Y102C	probably damaging	Het
Olfr522	T	A	7: 140,162,909	I14F	possibly damaging	Het
Olfr910	T	A	9: 38,539,280	N128K	probably benign	Het
Osmr	T	C	15: 6,815,415	N957D	probably benign	Het
Parn	G	A	16: 13,603,069	S473L	probably damaging	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Pole2	G	A	12: 69,228,152	R5W	probably benign	Het
Prl7a2	T	A	13: 27,660,887	Y172F	probably damaging	Het
Ptprz1	A	G	6: 23,050,389		probably benign	Het
Rapgef3	C	A	15: 97,766,961	G7V	probably damaging	Het
Ripor1	T	A	8: 105,617,708	S491R	probably benign	Het
Rnf141	A	G	7: 110,821,365		probably benign	Het
Ryr3	C	T	2: 112,946,957	R285Q	probably damaging	Het
Sall4	T	C	2: 168,756,545	N125S	probably benign	Het
Schip1	A	G	3: 68,617,786	K360R	probably damaging	Het
Senp6	T	A	9: 80,089,869	V55E	probably benign	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Slc25a16	T	A	10: 62,932,751	H130Q	probably benign	Het
Styx	T	C	14: 45,373,563	V217A	probably benign	Het
Syne2	G	A	12: 75,888,342		probably null	Het
Tagap1	A	G	17: 6,956,860	S146P	probably benign	Het
Tatdn2	A	G	6: 113,704,142	K379E	probably benign	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Tle2	T	C	10: 81,580,551	L135P	probably damaging	Het
Tmc1	A	G	19: 20,824,309	F451S	possibly damaging	Het
Trpm7	G	A	2: 126,797,727	P1650S	probably damaging	Het
Ttll4	G	A	1: 74,680,382	R16H	possibly damaging	Het
Ttn	T	C	2: 76,714,373	N32795S	probably damaging	Het
Tubgcp6	T	C	15: 89,104,489	E803G	probably benign	Het
Ubr2	A	G	17: 46,963,145		probably null	Het
Ugt2b35	A	G	5: 87,001,553	D221G	probably damaging	Het
Unc45b	G	A	11: 82,911,689	A4T	probably benign	Het
Vmn1r70	A	T	7: 10,634,337	I251F	possibly damaging	Het
Vmn2r120	T	A	17: 57,524,553	H412L	possibly damaging	Het
Zfp59	A	G	7: 27,853,510	N129S	probably benign	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7914:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7994:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCCTAAGGGCATCCAGAC -3'
(R):5'- GGCCTTAACGTTTGGGCTAAG -3'

Sequencing Primer
(F):5'- CAGACAACCCAGGGACAGTG -3'
(R):5'- GCTAAGCCTGTCCCACTG -3'

Posted On

2014-09-17