Incidental Mutation 'R2067:Pik3c2b'
ID 226723
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 040072-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R2067 (G1)
Quality Score 190
Status Validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133027349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1283 (S1283P)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: S1283P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: S1283P

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Meta Mutation Damage Score 0.1663 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Abca2 A T 2: 25,327,517 (GRCm39) I669F possibly damaging Het
Acin1 T A 14: 54,902,711 (GRCm39) Q360H probably damaging Het
Aldh3b1 T A 19: 3,971,755 (GRCm39) D72V probably benign Het
Alox12e G A 11: 70,206,828 (GRCm39) R620W probably damaging Het
Alpl T C 4: 137,476,856 (GRCm39) probably benign Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ascc2 A T 11: 4,631,496 (GRCm39) M646L probably benign Het
Bod1l G A 5: 41,974,429 (GRCm39) T2295M probably benign Het
Ccdc9 A T 7: 16,012,475 (GRCm39) probably null Het
Clptm1l C T 13: 73,755,842 (GRCm39) Q153* probably null Het
Csmd1 A G 8: 15,950,782 (GRCm39) S3476P probably benign Het
Ddias A T 7: 92,508,907 (GRCm39) M336K possibly damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Epha1 G T 6: 42,342,987 (GRCm39) H187Q probably benign Het
Espl1 T C 15: 102,207,525 (GRCm39) S330P probably damaging Het
Fbln7 G T 2: 128,719,386 (GRCm39) R61L probably damaging Het
Fbxo41 C T 6: 85,455,453 (GRCm39) W577* probably null Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Gc T A 5: 89,594,376 (GRCm39) K37N probably damaging Het
Gfpt1 T C 6: 87,034,736 (GRCm39) I178T probably benign Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm3944 C A 12: 18,903,895 (GRCm39) S8* probably null Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Gpr156 A G 16: 37,799,113 (GRCm39) D109G probably benign Het
Hoxd1 A T 2: 74,593,710 (GRCm39) T89S probably benign Het
Htt C T 5: 34,983,326 (GRCm39) T975I probably benign Het
Itpr3 G A 17: 27,317,050 (GRCm39) M768I probably benign Het
Krt4 C A 15: 101,833,099 (GRCm39) A3S possibly damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Mup4 T A 4: 59,960,622 (GRCm39) probably benign Het
Myh1 G A 11: 67,105,446 (GRCm39) D1079N possibly damaging Het
Myo1a A G 10: 127,541,347 (GRCm39) N43D probably benign Het
Napa A T 7: 15,849,203 (GRCm39) probably benign Het
Ndufa12 A G 10: 94,056,569 (GRCm39) D99G probably damaging Het
Neb A G 2: 52,174,275 (GRCm39) I1528T probably benign Het
Nek1 T C 8: 61,460,196 (GRCm39) S41P probably damaging Het
Nolc1 C T 19: 46,072,046 (GRCm39) T612M probably damaging Het
Nsun5 T G 5: 135,403,926 (GRCm39) Y301D probably damaging Het
Oas1g T C 5: 121,023,946 (GRCm39) E121G probably damaging Het
Or1e1f A G 11: 73,855,740 (GRCm39) Y102C probably damaging Het
Or2ab1 A G 11: 58,488,396 (GRCm39) N58S probably damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or6ae1 T A 7: 139,742,822 (GRCm39) I14F possibly damaging Het
Or8b46 T A 9: 38,450,576 (GRCm39) N128K probably benign Het
Or8k38 G T 2: 86,488,781 (GRCm39) T7K probably damaging Het
Osmr T C 15: 6,844,896 (GRCm39) N957D probably benign Het
Parn G A 16: 13,420,933 (GRCm39) S473L probably damaging Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Pole2 G A 12: 69,274,926 (GRCm39) R5W probably benign Het
Prl7a2 T A 13: 27,844,870 (GRCm39) Y172F probably damaging Het
Ptprz1 A G 6: 23,050,388 (GRCm39) probably benign Het
Rapgef3 C A 15: 97,664,842 (GRCm39) G7V probably damaging Het
Ripor1 T A 8: 106,344,340 (GRCm39) S491R probably benign Het
Rnf141 A G 7: 110,420,572 (GRCm39) probably benign Het
Ryr3 C T 2: 112,777,302 (GRCm39) R285Q probably damaging Het
Sall4 T C 2: 168,598,465 (GRCm39) N125S probably benign Het
Schip1 A G 3: 68,525,119 (GRCm39) K360R probably damaging Het
Senp6 T A 9: 79,997,151 (GRCm39) V55E probably benign Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Slc25a16 T A 10: 62,768,530 (GRCm39) H130Q probably benign Het
Styx T C 14: 45,611,020 (GRCm39) V217A probably benign Het
Syne2 G A 12: 75,935,116 (GRCm39) probably null Het
Tagap1 A G 17: 7,224,259 (GRCm39) S146P probably benign Het
Tatdn2 A G 6: 113,681,103 (GRCm39) K379E probably benign Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Tle2 T C 10: 81,416,385 (GRCm39) L135P probably damaging Het
Tmc1 A G 19: 20,801,673 (GRCm39) F451S possibly damaging Het
Trpm7 G A 2: 126,639,647 (GRCm39) P1650S probably damaging Het
Ttll4 G A 1: 74,719,541 (GRCm39) R16H possibly damaging Het
Ttn T C 2: 76,544,717 (GRCm39) N32795S probably damaging Het
Tubgcp6 T C 15: 88,988,692 (GRCm39) E803G probably benign Het
Ubr2 A G 17: 47,274,071 (GRCm39) probably null Het
Ugt2b35 A G 5: 87,149,412 (GRCm39) D221G probably damaging Het
Unc45b G A 11: 82,802,515 (GRCm39) A4T probably benign Het
Vmn1r70 A T 7: 10,368,264 (GRCm39) I251F possibly damaging Het
Vmn2r120 T A 17: 57,831,553 (GRCm39) H412L possibly damaging Het
Zfp59 A G 7: 27,552,935 (GRCm39) N129S probably benign Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTAAGGGCATCCAGAC -3'
(R):5'- GGCCTTAACGTTTGGGCTAAG -3'

Sequencing Primer
(F):5'- CAGACAACCCAGGGACAGTG -3'
(R):5'- GCTAAGCCTGTCCCACTG -3'
Posted On 2014-09-17